App-Sandy

 view release on metacpan or  search on metacpan

Makefile.PL  view on Meta::CPAN


WriteMakefile(%WriteMakefileArgs);

package MY;

use File::ShareDir::Install;

# These two are necessary to keep bmake happy
sub xs_c {
	my $self = shift;
	my $ret = $self->SUPER::xs_c(@_);
	$ret =~ s/\$\*\.xs/\$</g;
	$ret =~ s/\$\*\.c\b/\$@/g;
	return $ret;
}

sub c_o {
	my $self = shift;
	my $ret = $self->SUPER::c_o(@_);
	$ret =~ s/\$\*\.c\b/\$</g;
	$ret =~ s/\$\*\$\(OBJ_EXT\)/\$@/g;
	return $ret;
}

sub const_cccmd {
	my $ret = shift->SUPER::const_cccmd(@_);
	return q{} unless $ret;

	$ret .= ' -o $@';

	return $ret;
}

# Fix shared object path
sub constants {
	my $self = shift;
	my $ret = $self->SUPER::constants(@_);
	$ret =~ s|(?<=\nFULLEXT).*\n| = App/Sandy/RNG\n|;
	$ret =~ s|(?<=\nBASEEXT).*\n| = RNG\n|;
	return $ret;
}

sub postamble {
	my $self = shift;
	my @ret = File::ShareDir::Install::postamble($self);

	my $cmd = q{

inc/SandyMakeMaker.pm  view on Meta::CPAN

	my $template = super();

	$template .= << 'TEMPLATE';
package MY;

use File::ShareDir::Install;

# These two are necessary to keep bmake happy
sub xs_c {
	my $self = shift;
	my $ret = $self->SUPER::xs_c(@_);
	$ret =~ s/\$\*\.xs/\$</g;
	$ret =~ s/\$\*\.c\b/\$@/g;
	return $ret;
}

sub c_o {
	my $self = shift;
	my $ret = $self->SUPER::c_o(@_);
	$ret =~ s/\$\*\.c\b/\$</g;
	$ret =~ s/\$\*\$\(OBJ_EXT\)/\$@/g;
	return $ret;
}

sub const_cccmd {
	my $ret = shift->SUPER::const_cccmd(@_);
	return q{} unless $ret;

	$ret .= ' -o $@';

	return $ret;
}

# Fix shared object path
sub constants {
	my $self = shift;
	my $ret = $self->SUPER::constants(@_);
	$ret =~ s|(?<=\nFULLEXT).*\n| = App/Sandy/RNG\n|;
	$ret =~ s|(?<=\nBASEEXT).*\n| = RNG\n|;
	return $ret;
}

sub postamble {
	my $self = shift;
	my @ret = File::ShareDir::Install::postamble($self);

	my $cmd = q{

t/lib/TestsFor/App/Sandy/PieceTable.pm  view on Meta::CPAN

package TestsFor::App::Sandy::PieceTable;
# ABSTRACT: Tests for 'App::Sandy::PieceTable' class

use App::Sandy::Base 'test';
#use Data::Dumper;
use base 'TestsFor';

sub startup : Tests(startup) {
	my $test = shift;
	$test->SUPER::startup;

	my $class = ref $test;
	$class->mk_classdata('default_attr');
	$class->mk_classdata('default_seq');
	$class->mk_classdata('default_table');
}

sub setup : Tests(setup) {
	my $test = shift;
	$test->SUPER::setup;

	my $seq = "A large span of text";
	my %default_attr = (orig => \$seq);

	$test->default_seq(\$seq);
	$test->default_attr(\%default_attr);
	$test->default_table($test->class_to_test->new(%default_attr));
}

sub constructor : Tests(2) {

t/lib/TestsFor/App/Sandy/Quality.pm  view on Meta::CPAN

use base 'TestsFor';

use constant {
	SEQ_SYS       => "poisson",
	QUALITY_SIZE  => 10,
	SEED          => 17
};

sub startup : Tests(startup) {
	my $test = shift;
	$test->SUPER::startup;
	my $class = ref $test;
	$class->mk_classdata('default_quality');
	$class->mk_classdata('default_attr');
	$class->mk_classdata('rng');
}

sub setup : Tests(setup) {
	my $test = shift;
	my %child_arg = @_;
	$test->SUPER::setup;

	my %default_attr = (
		quality_profile => SEQ_SYS,
		%child_arg
	);

	$test->default_attr(\%default_attr);
	$test->default_quality($test->class_to_test->new(%default_attr));
	$test->rng(App::Sandy::RNG->new(SEED));
}

t/lib/TestsFor/App/Sandy/RNG.pm  view on Meta::CPAN

package TestsFor::App::Sandy::RNG;
# ABSTRACT: Tests for 'App::Sandy::RNG' class

use App::Sandy::Base 'test';
use base 'TestsFor';

sub startup : Tests(startup) {
	my $test = shift;
	$test->SUPER::startup;

	my $class = ref $test;

	$class->mk_classdata('default_rand');
	$class->mk_classdata('default_seed');
}

sub setup : Tests(setup) {
	my $test = shift;
	$test->SUPER::setup;

	$test->default_seed(27);
	$test->default_rand($test->class_to_test->new(27));
}

sub constructor : Tests(1) {
	my $test = shift;

	my $class = $test->class_to_test;
	my $rand = $test->default_rand;

t/lib/TestsFor/App/Sandy/Read.pm  view on Meta::CPAN

use App::Sandy::RNG;
#use Data::Dumper;
use base 'TestsFor';

use constant {
	SEED => 17
};

sub startup : Tests(startup) {
	my $test = shift;
	$test->SUPER::startup;
	my $class = ref $test;
	$class->mk_classdata('default_read');
	$class->mk_classdata('default_attr');
	$class->mk_classdata('seq');
	$class->mk_classdata('seq_len');
	$class->mk_classdata('table');
	$class->mk_classdata('table_seq');
	$class->mk_classdata('slice_len');
	$class->mk_classdata('rng');
}

sub setup : Tests(setup) {
	my $test = shift;
	my %child_arg = @_;
	$test->SUPER::setup;

	my %default_attr = (
		sequencing_error => 0.1,
		%child_arg
	);

	my $seq = 'TGACCCGCTAACCTCAGTTCTGCAGCAGTAACAACTGCCGTATCTGGACTTTCCTAATACCTCGCATAGTCCGTCCCCTCGCGCGGCAAGAGGTGCGGCG';
	my $table_seq = "A large span of text";

	$test->default_attr(\%default_attr);

t/lib/TestsFor/App/Sandy/Read/PairedEnd.pm  view on Meta::CPAN

package TestsFor::App::Sandy::Read::PairedEnd;
# ABSTRACT: Tests for 'App::Sandy::Read::PairedEnd' class

use App::Sandy::Base 'test';
use base 'TestsFor::App::Sandy::Read';

sub startup : Tests(startup) {
	my $test = shift;
	my $class = ref $test;
	$test->SUPER::startup;
	$class->mk_classdata('table_read');
}

sub setup : Tests(setup) {
	my $test = shift;

	my %default_attr = (
		fragment_mean    => 50,
		fragment_stdd    => 10
	);

	$test->SUPER::setup(%default_attr);

	my $seq = $test->seq;
	$test->table_read(App::Sandy::PieceTable->new(orig => \$seq));
	$test->table_read->calculate_logical_offset;
}

sub constructor : Tests(8) {
	my $test = shift;

	my $class = $test->class_to_test;

t/lib/TestsFor/App/Sandy/Read/SingleEnd.pm  view on Meta::CPAN

package TestsFor::App::Sandy::Read::SingleEnd;
# ABSTRACT: Tests for 'App::Sandy::Read::SingleEnd' class

use App::Sandy::Base 'test';
use base 'TestsFor::App::Sandy::Read';

sub startup : Tests(startup) {
	my $test = shift;
	my $class = ref $test;
	$test->SUPER::startup;
	$class->mk_classdata('table_read');
}

sub setup : Tests(setup) {
	my $test = shift;
	$test->SUPER::setup;
	my $seq = $test->seq;
	$test->table_read(App::Sandy::PieceTable->new(orig => \$seq));
	$test->table_read->calculate_logical_offset;
}

sub gen_read : Tests(50) {
	my $test = shift;

	my $read = $test->default_read;
	my $seq = $test->seq;

t/lib/TestsFor/App/Sandy/Seq.pm  view on Meta::CPAN

use autodie;

use constant {
	SEQ_SYS       => 'poisson',
	QUALITY_SIZE  => 10,
	SEED          => 17
};

sub startup : Tests(startup) {
	my $test = shift;
	$test->SUPER::startup;
	my $class = ref $test;
	$class->mk_classdata('default_fastq');
	$class->mk_classdata('default_attr');
	$class->mk_classdata('seq');
	$class->mk_classdata('seq_len');
	$class->mk_classdata('rng');
}

sub setup : Tests(setup) {
	my $test = shift;
	my %child_arg = @_;
	$test->SUPER::setup;

	my %default_attr = (
		quality_profile  => SEQ_SYS,
		read_mean        => QUALITY_SIZE,
		read_stdd        => 0,
		sequencing_error => 0.1,
		template_id      => 'ponga_header',
		format           => 'fastq',
		%child_arg
	);

t/lib/TestsFor/App/Sandy/Seq/PairedEnd.pm  view on Meta::CPAN

package TestsFor::App::Sandy::Seq::PairedEnd;
# ABSTRACT: Tests for 'App::Sandy::Seq::PairedEnd' class

use App::Sandy::Base 'test';
use App::Sandy::PieceTable;
use base 'TestsFor::App::Sandy::Seq';

sub startup : Tests(startup) {
	my $test = shift;
	my $class = ref $test;
	$test->SUPER::startup;
	$class->mk_classdata('table_read');
}

sub setup : Tests(setup) {
	my $test = shift;

	my %default_attr = (
		fragment_mean => 50,
		fragment_stdd => 10,
		template_id   => 'sr0001 simulation_read length=%r position=%c:%t-%n'
	);

	$test->SUPER::setup(%default_attr);
	my $seq = $test->seq;
	$test->table_read(App::Sandy::PieceTable->new(orig => \$seq));
	$test->table_read->calculate_logical_offset;
}

sub cleanup : Tests(shutdown) {
	my $test = shift;
	$test->SUPER::shutdown;
}

sub constructor : Tests(16) {
	my $test = shift;

	my $class = $test->class_to_test;
	my $fastq = $test->default_fastq;
	my %default_attr = %{ $test->default_attr };

	while (my ($attr, $value) = each %default_attr) {

t/lib/TestsFor/App/Sandy/Seq/SingleEnd.pm  view on Meta::CPAN

package TestsFor::App::Sandy::Seq::SingleEnd;
# ABSTRACT: Tests for 'App::Sandy::Seq::SingleEnd' class

use App::Sandy::Base 'test';
use App::Sandy::PieceTable;
use base 'TestsFor::App::Sandy::Seq';

sub startup : Tests(startup) {
	my $test = shift;
	my $class = ref $test;
	$test->SUPER::startup;
	$class->mk_classdata('table_read');
}

sub setup : Tests(setup) {
	my $test = shift;

	my %default_attr = (
		template_id => 'sr0001 simulation_read length=%r position=%c:%a-%b'
	);

	$test->SUPER::setup(%default_attr);
	my $seq = $test->seq;
	$test->table_read(App::Sandy::PieceTable->new(orig => \$seq));
	$test->table_read->calculate_logical_offset;
}

sub cleanup : Tests(shutdown) {
	my $test = shift;
	$test->SUPER::shutdown;
}

sub constructor : Tests(12) {
	my $test = shift;

	my $class = $test->class_to_test;
	my $fastq = $test->default_fastq;
	my %default_attr = %{ $test->default_attr };

	while (my ($attr, $value) = each %default_attr) {

t/lib/TestsFor/App/Sandy/Simulator.pm  view on Meta::CPAN

	GENOME            => '.data.fa',
	GENOME_SIZE       => 2280,
	PREFIX            => 'ponga',
	OUTPUT_SINGLE_END => 'ponga_R1_001.fastq',
	OUTPUT_PAIRED_END => ['ponga_R1_001.fastq', 'ponga_R2_001.fastq'],
	OUTPUT_COUNTS     => 'ponga_coverage.tsv'
};

sub startup : Tests(startup) {
	my $test = shift;
	$test->SUPER::startup;
	my $class = ref $test;
	$class->mk_classdata('default_attr');
	$class->mk_classdata('default_sg_single_end');
	$class->mk_classdata('default_sg_paired_end');

	my $fasta = q{>Chr1
TTACTGCTTTTAACATTACAGTAACTGTTACAGGTTCCAGCAGGCTAACTGGGTGGAAAT
GAGTTTGGTTTCACTTAGTCTCTCTAAAGAGAAAGCAAGTCGGTAGACTAATACCTAATA
AAAGCAAAGCTGCCAACAATTGAAATTGCCTAGGCTGCTCTGTGTGTCCCACATGCATGG
GTGTGGGTGCCAGTGTGTGTGCGTGTGTGCATGCATGTGCATGTGTGTTGGGATAGAGTG

t/lib/TestsFor/App/Sandy/Simulator.pm  view on Meta::CPAN

CAGGAGAAATGTATTAATGTGCCTTTCTAGTAACAGGTTTTTAGAAAGTCAAATATAAAC};

	open my $fh, ">" => GENOME;
	print $fh "$fasta\n";
	close $fh;
}

sub setup : Tests(setup) {
	my $test = shift;
	$LOG_VERBOSE = VERBOSE;
	$test->SUPER::setup;

	my %default_attr = (
		argv              => [qw/ponga 1 2 3 4 5/],
		truncate          => 0,
		join_paired_ends  => 0,
		prefix            => PREFIX,
		fasta_file        => GENOME,
		coverage          => COVERAGE,
		jobs              => JOBS,
		output_format     => FORMAT,

t/lib/TestsFor/App/Sandy/Simulator.pm  view on Meta::CPAN

	);

	$test->default_attr(\%default_attr);
	$test->default_sg_single_end($test->class_to_test->new(%sg_single_end));
	$test->default_sg_paired_end($test->class_to_test->new(%sg_paired_end));
}

sub cleanup : Tests(shutdown) {
	my $test = shift;
	unlink GENOME;
	$test->SUPER::shutdown;
}

sub constructor : Tests(26) {
	my $test = shift;

	my $class = $test->class_to_test;
	my $sg = $test->default_sg_single_end;
	my %default_attr = %{ $test->default_attr };

	while (my ($attr, $value) = each %default_attr) {



( run in 3.318 seconds using v1.01-cache-2.11-cpan-98e64b0badf )