view release on metacpan or  search on metacpan

inc/inc_File-Fetch/File/Fetch.pm  view on Meta::CPAN

        ) {
            return $self->_error(loc("Command failed: %1", $captured || ''));
        }

        ### print to local file ###
        ### XXX on a 404 with a special error page, $captured will actually
        ### hold the contents of that page, and make it *appear* like the
        ### request was a success, when really it wasn't :(
        ### there doesn't seem to be an option for lynx to change the exit
        ### code based on a 4XX status or so.
        ### the closest we can come is using --error_file and parsing that,

inc/inc_File-Fetch/File/Fetch.pm  view on Meta::CPAN

=head2 I used 'lynx' to fetch a file, but its contents is all wrong!

C<lynx> can only fetch remote files by dumping its contents to C<STDOUT>,
which we in turn capture. If that content is a 'custom' error file
(like, say, a C<404 handler>), you will get that contents instead.

Sadly, C<lynx> doesn't support any options to return a different exit
code on non-C<200 OK> status, giving us no way to tell the difference
between a 'successful' fetch and a custom error page.

 view release on metacpan or  search on metacpan

Changes  view on Meta::CPAN

1.405  Wed June 2nd 2010
     - searching more ld paths for libs [kthakore] {ticket #153}
     - removes old share dirs installs of Alien [kthakore]
     - searching for .dylib's, .so's and .bundle's on mac [FROGGS]

1.404  Thu May 13 2010
     - added new binaries for Win64 with fb/pango patch [kmx]

1.403  Sat May 01 2010
     - added Text::Patch to configure_requires [FROGGS]

 view release on metacpan or  search on metacpan

inc/My/Utility.pm  view on Meta::CPAN

        version => '1.2.8',
        dirname => 'zlib-1.2.8',
        url => [
          'http://zlib.net/zlib-1.2.8.tar.gz'
        ],
        sha1sum  => 'a4d316c404ff54ca545ea71a27af7dbc29817088',
        patches => [],
        prereq_libs => [],
      },
      {
        pack => 'jpeg',

 view release on metacpan or  search on metacpan

src/subversion/CHANGES  view on Meta::CPAN

    * enforce strict version equality between tools and libraries (r1502267)
    * consistently output revisions as "r%ld" in error messags (r1499044 et al)

  - Client-side bugfixes:
    * status: always use absolute paths in XML output (issue #4398)
    * ra_serf: 'svn log -v' fails with a 1.2.x server (issue #4044)
    * ra_serf: fix crash when committing cp with deep deletion (issue #4400)
    * diff: issue an error for files that can't fit in memory (r1513119 et al)
    * svnmucc: generate proper error for mismatched URLs (r1511353)
    * update: fix a crash when a temp file doesn't exist (r1513156)
    * commit & update: improve sleep for timestamps performance (r1508438)

src/subversion/CHANGES  view on Meta::CPAN

    * 'svn status' with better NLS support (r1157537, -682)
    * better tracking of shallow-yet-complete merges (issues #4056, #4057)
    * make 'svn status --quiet' w/ externals quieter still (issue #1935)
    * ensure that conflict paths are shown relative-ized (r1337520)
    * improve performance of local multi-target deletions (r1195873)
    * various interactive conflict resolver improvements in 'svn' (r1440421 etc)
    * improved tree diff implementation for diff and merge (r1440599 et al)
    * tree conflicts on directories detected better during merges (issue #3150)
    * allow reverting unmodified copies with 'svn remove' (r1442611)
    * make 'svn diff' with mixed URL and local path targets work (r1442640)
    * make 'svn patch' re-add deleted directories if needed (r1445333)

src/subversion/CHANGES  view on Meta::CPAN

    * improve interactive resolution of property conflicts (r1387678 et al)
    * make ra_serf raise an error upon delta-base mismatch (issue #4235)
    * tune ra_svn transmit buffer handling (r1391788)
    * make 'svnrdump' work with serf (issue #4116)
    * fix 'svnrdump' on path below repository root (issue #4101)
    * support ipv6 in URLs (e.g. http://[::1]/svn/repos) (r1454047)
    * conflict resolver now iterates paths in a sorted order (r1461820)
    * mod_dav_svn does keyword expansion with 'kw=1' query arg (r1466055)

  - Minor new features and improvements (server-side):
    * improve performance of config file parsing (r1344347 et al)

src/subversion/CHANGES  view on Meta::CPAN

    * reduce memory usage during checkout and export (r1564215)

 Developer-visible changes:
  - General:
    * fix failure in checkout_tests.py
    * support compiling against Cyrus sasl 2.1.25 (r1404912, r1413402)
    * support compiling against neon 0.30.x (r1566320)


Version 1.7.15
(Not released, see changes for 1.7.16.)

src/subversion/CHANGES  view on Meta::CPAN

    * fix assertion during 'svn diff -r BASE:HEAD ^/trunk' (issue #4161)
    * notify upon 'update' just removing locks on files (r1329876)
    * neon: fix potential use of freed memory during commits (r1329388)
    * 'status --xml' doesn't show repository deletes correctly (issue #4167)
    * fix assert on svn:externals with drive letter on Windows (issue #4073)
    * fix 'svn update --depth=empty' against 1.4 servers (issue #4046)
    * handle missing svn:date reported by svnserve gracefully (r1306111)
    * fix merges which first add a subtree and then delete it (issue #4166)
    * fix a regression with checkout of file externals (issue #4087)
    * don't add spurious mergeinfo to subtrees in edge-case merge (issue #4169)
    * improve performance of status on large working copies (issue #4178)

src/subversion/CHANGES  view on Meta::CPAN

Version 1.7.2
(02 Dec 2011, from /branches/1.7.x)
http://svn.apache.org/repos/asf/subversion/tags/1.7.2

  User-visible changes:
   * fix working copy corruption after interrupted update/switch (issue #4040)
   * avoid segfaults against pre-1.5 servers (r1186928)
   * improve configure error message if apr-util uses old or no bdb (r1186784)
   * make 'svn patch' ignore '/dev/null' targets for compat with git (r1197998)
   * fix 'svn patch' segfault on patch that skips and deletes files (r1199950)
   * omit "Committed revision N." output from 'svn commit --quiet' (r1200837)

src/subversion/CHANGES  view on Meta::CPAN

   * fix nested <Location>s when using v2 protocol (r1203546, -651, -653)
   * make mod_dav_svn ignore non-Subversion POST requests (r1187695)
   * avoid reading freed memory (r1204478)
   * recognize empty (only byte order mark) UTF-8 files as text (issue #4064)
   * fix 1.7 client regression when operating against a 1.0.x server (r1199876)
   * remove empty parent dirs of removed externals on update (issue #4044)
   * make 'svn diff -c N' work for files added in rN (issue #2873)
   * plug a memory leak in the bdb backend (r1205726)
   * fix 'svn import' with native eol-style and inconsistent EOLs (r1205193)
   * fix reading beyond the end of a string in bdb backend (r1205839, -48)
   * don't assert when committing an incomplete directory (issue #4042)

  Developer-visible changes:
   * JavaHL: allow 'status -u' to function properly (r1189190, -395)
   * don't put '\r' characters in our generate sql headers (r1189580)
   * properly define WIN64 on Windows x64 builds (r1188609)

src/subversion/CHANGES  view on Meta::CPAN

http://svn.apache.org/repos/asf/subversion/tags/1.6.3

 User-visible changes:
  * fix segfault in WC->URL copy (r37646, -56)
  * let 'svnadmin load' tolerate mergeinfo with "\r\n" (r37768)
  * make svnsync normalize svn:* props to LF line endings (issue #3404)
  * better integration with external merge tools (r36178)
  * return a friendly error message for 'svn diff' (r37735)
  * update dsvn.el for 1.6 (r37774)
  * don't allow setting of props on out-of-date dirs under neon (r37745)
  * improve BASH completion (r36450, -52, -70, -79, -538)

src/subversion/CHANGES  view on Meta::CPAN

  - Server:
    * fixed: set svn:date at the end of commit in fsfs (r18078)
    * fixed: don't wait for hook script background jobs (r18146)
    * fixed: mod_dav_svn should log the whole error chain (r18211)
    * fixed: uncomment section headers in repos config files (r18247, -50)
    * fixed: log scalability issues with many paths (r18395, -404)
    * fixed: better path input validation in mod_dav_svn (r18660)
    * fixed: assert in copy in fsfs and bdb (issue #2398)
    * fixed: RPM package bad interaction with NFS servers (issue #1456)

  - Both:

src/subversion/CHANGES  view on Meta::CPAN

       - 'svn add/import --no-ignore'  (issue #2105)
       - 'svnlook tree --full-paths'  (r13976)
       - 'svnlook diff --diff-copy-from'  (r14855)
       - 'svnlook changed --copy-info' (r16681)
    * fixed: 'svn copy wc URL' might include deleted items (issue #2153)
    * fixed: 'svn copy wc wc' allows cross-repository copies (issue #2404)
    * fixed: 'svn up/merge' major property-merging bugs (issue #2035)
    * fixed: 'svn merge' insisting on write access to '.' (issue #2411)
    * fixed: 'svn merge' cross-device move problems (r16293, -329, -330)
    * fixed: 'svn diff' outputs headers in wrong encoding (issue #1533)
    * fixed: 'svn proplist/add/cat' dies on unversioned items (issue #2030)

 view release on metacpan or  search on metacpan

inc/Module/Load/Conditional.pm  view on Meta::CPAN

    } else {
        return 1;
    }
}

#line 404

sub requires {
    my $who = shift;

    unless( check_install( module => $who ) ) {

 view release on metacpan or  search on metacpan

share/swagger-ui-bundle.js  view on Meta::CPAN

/*!
 * https://github.com/Starcounter-Jack/JSON-Patch
 * (c) 2017 Joachim Wester
 * MIT license
 */
var n=this&&this.__extends||function(e,t){for(var n in t)t.hasOwnProperty(n)&&(e[n]=t[n]);function r(){this.constructor=e}e.prototype=null===t?Object.create(t):(r.prototype=t.prototype,new r)},r=Object.prototype.hasOwnProperty;function o(e,t){return ...
/** @license React v16.8.6
 * react-is.production.min.js
 *
 * Copyright (c) Facebook, Inc. and its affiliates.
 *
 * This source code is licensed under the MIT license found in the
 * LICENSE file in the root directory of this source tree.
 */Object.defineProperty(t,"__esModule",{value:!0});var r="function"==typeof Symbol&&Symbol.for,o=r?Symbol.for("react.element"):60103,i=r?Symbol.for("react.portal"):60106,a=r?Symbol.for("react.fragment"):60107,s=r?Symbol.for("react.strict_mode"):6010...
/*!
 * https://github.com/Starcounter-Jack/JSON-Patch
 * (c) 2017 Joachim Wester
 * MIT license
 */

 view release on metacpan or  search on metacpan

Changes  view on Meta::CPAN

6bc134c486aa7b9ddb3ae095cb8882c804802110 Updating the version.
353e459aa5ec946d52fc719b5263ee75bc7ab7f4 Adding a basic unit test so that cpan-testers shows that Alien::TALib is supported across various systems
4f7dc3b904deb05776991e631892f432493661f5 Adding license generation to the build_requires
c9af2b7904bbecd45910141dc35b2dc7bb1f58c6 Updating to manage dependencies for license creation.
ff783d6f6c1c5ca4c0d9980e15a85ba668b8eab2 Adding meta-resources for CPAN
866e76a0404670c34b1ae0d2849a787915f2a793 Adding SHA-1/256 sums to the mix.
83c3cccb2893a08b22802c22f635840ed1da4c89 README update
34479d38123758ba18fe3154ca2b68d3221d181f Updating code to handle the ta-lib-0.4.0
f55b20ac54ca3807953b83d8645e2ae359c9f3b7 Adding a dummy build system
e2391b5ecac4ea5722f3a421b306c58d50068501 Initial commit

 view release on metacpan or  search on metacpan

src/i386-gen.c  view on Meta::CPAN

        o(0x242cdf); /* fildll (%esp) */
        o(0x08c483); /* add $8, %esp */
    } else {
        /* int to float/double/long double */
        o(0x50 + (vtop->r & VT_VALMASK)); /* push r */
        o(0x2404db); /* fildl (%esp) */
        o(0x04c483); /* add $4, %esp */
    }
    vtop->r = TREG_ST0;
}

 view release on metacpan or  search on metacpan

src/i386-gen.c  view on Meta::CPAN

        o(0x242cdf); /* fildll (%esp) */
        o(0x08c483); /* add $8, %esp */
    } else {
        /* int to float/double/long double */
        o(0x50 + (vtop->r & VT_VALMASK)); /* push r */
        o(0x2404db); /* fildl (%esp) */
        o(0x04c483); /* add $4, %esp */
    }
    vtop->r = TREG_ST0;
}

 view release on metacpan or  search on metacpan

share/docs/app-1c3b39672c292d36e4a5ff05c1bb7035.js  view on Meta::CPAN

If you are unsure which license is appropriate for your use, please contact the sales department
at http://www.sencha.com/contact.

Build date: 2013-04-03 15:07:25
*/
var CodeMirror=(function(){function v(aN,aK){var b2={},bk=v.defaults;for(var aA in bk){if(bk.hasOwnProperty(aA)){b2[aA]=(aK&&aK.hasOwnProperty(aA)?aK:bk)[aA]}}var aE=document.createElement("div");aE.className="CodeMirror"+(b2.lineWrapping?" CodeMirro...

 view release on metacpan or  search on metacpan

share/vendor/css/bootstrap-responsive.css  view on Meta::CPAN

    margin-left: 34.18803418803419%;
    *margin-left: 34.081651209310785%;
  }
  .row-fluid .offset3 {
    margin-left: 28.205128205128204%;
    *margin-left: 28.0987452264048%;
  }
  .row-fluid .offset3:first-child {
    margin-left: 25.641025641025642%;
    *margin-left: 25.53464266230224%;
  }

 view release on metacpan or  search on metacpan

xgboost/dmlc-core/scripts/setup_nvcc.sh  view on Meta::CPAN

prefix=$1

# list of debs to download from nvidia

files=( \
  "http://developer.download.nvidia.com/compute/cuda/repos/ubuntu1404/x86_64/cuda-core-7-5_7.5-18_amd64.deb" \
  "http://developer.download.nvidia.com/compute/cuda/repos/ubuntu1404/x86_64/cuda-cublas-7-5_7.5-18_amd64.deb" \
  "http://developer.download.nvidia.com/compute/cuda/repos/ubuntu1404/x86_64/cuda-cublas-dev-7-5_7.5-18_amd64.deb" \
  "http://developer.download.nvidia.com/compute/cuda/repos/ubuntu1404/x86_64/cuda-cudart-7-5_7.5-18_amd64.deb" \
  "http://developer.download.nvidia.com/compute/cuda/repos/ubuntu1404/x86_64/cuda-cudart-dev-7-5_7.5-18_amd64.deb" \
  "http://developer.download.nvidia.com/compute/cuda/repos/ubuntu1404/x86_64/cuda-curand-7-5_7.5-18_amd64.deb" \
  "http://developer.download.nvidia.com/compute/cuda/repos/ubuntu1404/x86_64/cuda-curand-dev-7-5_7.5-18_amd64.deb" \
  "http://developer.download.nvidia.com/compute/cuda/repos/ubuntu1404/x86_64/cuda-nvrtc-7-5_7.5-18_amd64.deb" \
  "http://developer.download.nvidia.com/compute/cuda/repos/ubuntu1404/x86_64/cuda-nvrtc-dev-7-5_7.5-18_amd64.deb" \
  "http://developer.download.nvidia.com/compute/cuda/repos/ubuntu1404/x86_64/cuda-misc-headers-7-5_7.5-18_amd64.deb" \
  "http://developer.download.nvidia.com/compute/cuda/repos/ubuntu1404/x86_64/libcuda1-352_352.93-0ubuntu1_amd64.deb" \
)

for item in ${files[*]}
do
    wget ${item}

 view release on metacpan or  search on metacpan

include/boost/config/compiler/gcc.hpp  view on Meta::CPAN

// GCC prior to 3.4 had #pragma once too but it didn't work well with filesystem links
#if BOOST_GCC_VERSION >= 30400
#define BOOST_HAS_PRAGMA_ONCE
#endif

#if BOOST_GCC_VERSION < 40400
// Previous versions of GCC did not completely implement value-initialization:
// GCC Bug 30111, "Value-initialization of POD base class doesn't initialize
// members", reported by Jonathan Wakely in 2006,
// http://gcc.gnu.org/bugzilla/show_bug.cgi?id=30111 (fixed for GCC 4.4)
// GCC Bug 33916, "Default constructor fails to initialize array members",

include/boost/config/compiler/gcc.hpp  view on Meta::CPAN

#  define BOOST_NO_CXX11_STATIC_ASSERT
#endif

// C++0x features in 4.4.n and later
//
#if (BOOST_GCC_VERSION < 40400) || !defined(BOOST_GCC_CXX11)
#  define BOOST_NO_CXX11_AUTO_DECLARATIONS
#  define BOOST_NO_CXX11_AUTO_MULTIDECLARATIONS
#  define BOOST_NO_CXX11_CHAR16_T
#  define BOOST_NO_CXX11_CHAR32_T
#  define BOOST_NO_CXX11_HDR_INITIALIZER_LIST

 view release on metacpan or  search on metacpan

MANIFEST  view on Meta::CPAN

libcares/test/fuzzinput/05ba948578a397e9cbc6a7b3e78622fa
libcares/test/fuzzinput/060afe5ed25f3e2e86167e545f27edca
libcares/test/fuzzinput/06d47d3681493f1b1d41236f460d896f
libcares/test/fuzzinput/0724a810b0e131c2fddb6de9003b9064
libcares/test/fuzzinput/0b5279148826f5b962bcf1896bdb4ede
libcares/test/fuzzinput/114048c0f6b10bdc67ce9166405d195e
libcares/test/fuzzinput/11b8464a0ef8735d202955c34c36b0c7
libcares/test/fuzzinput/11cb626f1668c7b41954ce7d768fe528
libcares/test/fuzzinput/14b133bf18125b75a1976fa63a1df6b7
libcares/test/fuzzinput/153c6b3afa8faa03c8bc28f936a6d4cf
libcares/test/fuzzinput/182cad2a342ed7317b7c21a5d17020d1

 view release on metacpan or  search on metacpan

src/catch.hpp  view on Meta::CPAN

            default:
                // Check for control characters and invalid utf-8

                // Escape control characters in standard ascii
                // see http://stackoverflow.com/questions/404107/why-are-control-characters-illegal-in-xml-1-0
                if (c < 0x09 || (c > 0x0D && c < 0x20) || c == 0x7F) {
                    hexEscapeChar(os, c);
                    break;
                }

 view release on metacpan or  search on metacpan

Changes  view on Meta::CPAN

    Requires accomodating change to
    Dist::Zilla::PluginBundle::Author::GETTY, see
    getty/p5-dist-zilla-pluginbundle-author-getty#5 for details 

  Change: bda03c7074dcb1c68d063a4404405621c36111bf
  Author: Wouter Verhelst <wouter.verhelst@zetes.com>
  Date : 2021-09-17 09:37:03 +0000

    Drop "ffserver" binary, which no longer exists since ffmpeg 4.0 

 view release on metacpan or  search on metacpan

patch/flex-2.6.4.diff  view on Meta::CPAN

+Name: libfl
+Description: Flex (the fast lexical analyzer) support library
+Version: @PACKAGE_VERSION@
+Libs: -L${libdir} -lfl
diff --git a/src/main.c b/src/main.c
index e5eac44..a4047d7 100644
--- a/src/main.c
+++ b/src/main.c
@@ -117,7 +117,7 @@ struct yytbl_writer tableswr;
 char   *program_name = "flex";
 

 view release on metacpan or  search on metacpan

SIGNATURE  view on Meta::CPAN

SHA256 500193142caa7c31a109e4af52737d48b9c31b10e071f98c865189634d8feedc Changes
SHA256 e9ae42c89b2f406c60c950a2a41695eabc2d324c0a9cd90d165e87c4e8a731bd LICENSE
SHA256 e690680c3203bc4ee2867ff05db419d59bc2adb7b5fdfd7286ea6cbaa8ed2411 MANIFEST
SHA256 d1c25cea1aae3e82c36c33bbc435c24ef16064cbea1bf4836d2029ae6820b4b7 META.json
SHA256 1d550a142981caab3b2bd891fd6c5be80bf576d6bb99a4d3c9082c329a07a637 META.yml
SHA256 404bf464b7a8cf2caf01a87d8a82b13e5af2ca047016f4258783bdda5404b8af Makefile.PL
SHA256 cde84cefbd9dc4659f43e42adab8dcaee20a39d3c2841aeb9b382aa3eb575544 README
SHA256 47f4ac976a6bc2b946afa66d82eb3f450af0c64a28436f42cd6ab545dc8eb5c6 alienfile
SHA256 9cb6d9b87035632988774076627aa79cbd93cf4046b52e6a6ecc6f23dd98497d examples/alien_librpm_variables.pl
SHA256 430c538c30ebe158629410ac298f5d296e571586989a7c37428837dee77c36e3 librpm.pm
SHA256 f2534757283ba0b532bebd0d355b0db81799b3e664628123be93a70c36f48eb8 t/Alien-librpm/01-use.t
SHA256 1738a0b5c4ac830d8b97c070fb9681d31ac2d5b34545dc22d6a38009f42febc9 t/Alien-librpm/02-version.t
SHA256 b15772266ac84bab3c2b91dd6ff1f65864bfdf135da4f2ce466df4153813b664 t/Alien-librpm/03-xs.t
SHA256 a3a778486452d513f9336940aacb742f91e0c44fb2fc273af4054212c7b893b8 xt/Alien-librpm/01-pod_coverage.t

 view release on metacpan or  search on metacpan

libsecp256k1/src/modules/ellswift/tests_impl.h  view on Meta::CPAN

 * authors' code. */
static const struct ellswift_xswiftec_inv_test ellswift_xswiftec_inv_tests[] = {
    {0xcc, SECP256K1_FE_CONST(0x05ff6bda, 0xd900fc32, 0x61bc7fe3, 0x4e2fb0f5, 0x69f06e09, 0x1ae437d3, 0xa52e9da0, 0xcbfb9590), SECP256K1_FE_CONST(0x80cdf637, 0x74ec7022, 0xc89a5a85, 0x58e373a2, 0x79170285, 0xe0ab2741, 0x2dbce510, 0xbdfe23fc), {SECP25...
    {0x33, SECP256K1_FE_CONST(0x1737a85f, 0x4c8d146c, 0xec96e3ff, 0xdca76d99, 0x03dcf3bd, 0x53061868, 0xd478c78c, 0x63c2aa9e), SECP256K1_FE_CONST(0x39e48dd1, 0x50d2f429, 0xbe088dfd, 0x5b61882e, 0x7e840748, 0x3702ae9a, 0x5ab35927, 0xb15f85ea), {SECP25...
    {0x00, SECP256K1_FE_CONST(0x1aaa1cce, 0xbf9c7241, 0x91033df3, 0x66b36f69, 0x1c4d902c, 0x228033ff, 0x4516d122, 0xb2564f68), SECP256K1_FE_CONST(0xc7554125, 0x9d3ba98f, 0x207eaa30, 0xc69634d1, 0x87d0b6da, 0x594e719e, 0x420f4898, 0x638fc5b0), {SECP25...
    {0x33, SECP256K1_FE_CONST(0x2323a1d0, 0x79b0fd72, 0xfc8bb62e, 0xc34230a8, 0x15cb0596, 0xc2bfac99, 0x8bd6b842, 0x60f5dc26), SECP256K1_FE_CONST(0x239342df, 0xb675500a, 0x34a19631, 0x0b8d87d5, 0x4f49dcac, 0x9da50c17, 0x43ceab41, 0xa7b249ff), {SECP25...
    {0x33, SECP256K1_FE_CONST(0x2dc90e64, 0x0cb646ae, 0x9164c0b5, 0xa9ef0169, 0xfebe34dc, 0x4437d6e4, 0x6acb0e27, 0xe219d1e8), SECP256K1_FE_CONST(0xd236f19b, 0xf349b951, 0x6e9b3f4a, 0x5610fe96, 0x0141cb23, 0xbbc8291b, 0x9534f1d7, 0x1de62a47), {SECP25...
    {0xcc, SECP256K1_FE_CONST(0x3edd7b39, 0x80e2f2f3, 0x4d1409a2, 0x07069f88, 0x1fda5f96, 0xf08027ac, 0x4465b63d, 0xc278d672), SECP256K1_FE_CONST(0x053a98de, 0x4a27b196, 0x1155822b, 0x3a3121f0, 0x3b2a1445, 0x8bd80eb4, 0xa560c4c7, 0xa85c149c), {SECP25...
    {0x00, SECP256K1_FE_CONST(0x4295737e, 0xfcb1da6f, 0xb1d96b9c, 0xa7dcd1e3, 0x20024b37, 0xa736c494, 0x8b625981, 0x73069f70), SECP256K1_FE_CONST(0xfa7ffe4f, 0x25f88362, 0x831c087a, 0xfe2e8a9b, 0x0713e2ca, 0xc1ddca6a, 0x383205a2, 0x66f14307), {SECP25...
    {0xff, SECP256K1_FE_CONST(0x587c1a0c, 0xee91939e, 0x7f784d23, 0xb963004a, 0x3bf44f5d, 0x4e32a008, 0x1995ba20, 0xb0fca59e), SECP256K1_FE_CONST(0x2ea98853, 0x0715e8d1, 0x0363907f, 0xf2512452, 0x4d471ba2, 0x454d5ce3, 0xbe3f0419, 0x4dfd3a3c), {SECP25...
    {0xcc, SECP256K1_FE_CONST(0x5fa88b33, 0x65a635cb, 0xbcee003c, 0xce9ef51d, 0xd1a310de, 0x277e441a, 0xbccdb7be, 0x1e4ba249), SECP256K1_FE_CONST(0x79461ff6, 0x2bfcbcac, 0x4249ba84, 0xdd040f2c, 0xec3c63f7, 0x25204dc7, 0xf464c16b, 0xf0ff3170), {SECP25...

libsecp256k1/src/modules/ellswift/tests_impl.h  view on Meta::CPAN

    {0x44, SECP256K1_FE_CONST(0xe0294c8b, 0xc1a36b41, 0x66ee92bf, 0xa70a5c34, 0x976fa982, 0x9405efea, 0x8f9cd54d, 0xcb29b99e), SECP256K1_FE_CONST(0xae9690d1, 0x3b8d20a0, 0xfbbf37be, 0xd8474f67, 0xa04e142f, 0x56efd787, 0x70a76b35, 0x9165d8a1), {SECP25...
    {0x00, SECP256K1_FE_CONST(0xe148441c, 0xd7b92b8b, 0x0e4fa3bd, 0x68712cfd, 0x0d709ad1, 0x98cace61, 0x1493c10e, 0x97f5394e), SECP256K1_FE_CONST(0x164a6397, 0x94d74c53, 0xafc4d329, 0x4e79cdb3, 0xcd25f99f, 0x6df45c00, 0x0f758aba, 0x54d699c0), {SECP25...
    {0xff, SECP256K1_FE_CONST(0xe4b00ec9, 0x7aadcca9, 0x7644d3b0, 0xc8a931b1, 0x4ce7bcf7, 0xbc877954, 0x6d6e35aa, 0x5937381c), SECP256K1_FE_CONST(0x94e9588d, 0x41647b3f, 0xcc772dc8, 0xd83c67ce, 0x3be00353, 0x8517c834, 0x103d2cd4, 0x9d62ef4d), {SECP25...
    {0x00, SECP256K1_FE_CONST(0xe5bbb9ef, 0x360d0a50, 0x1618f006, 0x7d36dceb, 0x75f5be9a, 0x620232aa, 0x9fd5139d, 0x0863fde5), SECP256K1_FE_CONST(0xe5bbb9ef, 0x360d0a50, 0x1618f006, 0x7d36dceb, 0x75f5be9a, 0x620232aa, 0x9fd5139d, 0x0863fde5), {SECP25...
    {0xff, SECP256K1_FE_CONST(0xe6bcb5c3, 0xd63467d4, 0x90bfa54f, 0xbbc6092a, 0x7248c25e, 0x11b248dc, 0x2964a6e1, 0x5edb1457), SECP256K1_FE_CONST(0x19434a3c, 0x29cb982b, 0x6f405ab0, 0x4439f6d5, 0x8db73da1, 0xee4db723, 0xd69b591d, 0xa124e7d8), {SECP25...
    {0x33, SECP256K1_FE_CONST(0xf28fba64, 0xaf766845, 0xeb2f4302, 0x456e2b9f, 0x8d80affe, 0x57e7aae4, 0x2738d7cd, 0xdb1c2ce6), SECP256K1_FE_CONST(0xf28fba64, 0xaf766845, 0xeb2f4302, 0x456e2b9f, 0x8d80affe, 0x57e7aae4, 0x2738d7cd, 0xdb1c2ce6), {SECP25...
    {0xcc, SECP256K1_FE_CONST(0xf455605b, 0xc85bf48e, 0x3a908c31, 0x023faf98, 0x381504c6, 0xc6d3aeb9, 0xede55f8d, 0xd528924d), SECP256K1_FE_CONST(0xd31fbcd5, 0xcdb798f6, 0xc00db669, 0x2f8fe896, 0x7fa9c79d, 0xd10958f4, 0xa194f013, 0x74905e99), {SECP25...
    {0xff, SECP256K1_FE_CONST(0xf58cd4d9, 0x830bad32, 0x2699035e, 0x8246007d, 0x4be27e19, 0xb6f53621, 0x317b4f30, 0x9b3daa9d), SECP256K1_FE_CONST(0x78ec2b3d, 0xc0948de5, 0x60148bbc, 0x7c6dc963, 0x3ad5df70, 0xa5a5750c, 0xbed72180, 0x4f082a3b), {SECP25...
    {0x00, SECP256K1_FE_CONST(0xfd7d912a, 0x40f182a3, 0x588800d6, 0x9ebfb504, 0x8766da20, 0x6fd7ebc8, 0xd2436c81, 0xcbef6421), SECP256K1_FE_CONST(0x8d37c862, 0x054debe7, 0x31694536, 0xff46b273, 0xec122b35, 0xa9bf1445, 0xac3c4ff9, 0xf262c952), {SECP25...
};

libsecp256k1/src/modules/ellswift/tests_impl.h  view on Meta::CPAN

    {{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0x27, 0x15, 0xde, 0x86, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff...
    {{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0x2c, 0x2c, 0x57, 0x09, 0xe7, 0x15, 0x6c, 0x41, 0x77, 0x17, 0xf2, 0xfe, 0xab...
    {{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0x3a, 0x08, 0xcc, 0x1e, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff...
    {{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0x3e, 0x91, 0x25, 0x7d, 0x93, 0x20, 0x16, 0xcb, 0xf6, 0x9c, 0x44, 0x71, 0xbd...
    {{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0x79, 0x5d, 0x6c, 0x1c, 0x32, 0x2c, 0xad, 0xf5, 0x99, 0xdb, 0xb8, 0x64, 0x81...
    {{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0x8e, 0x42, 0x6f, 0x03, 0x92, 0x38, 0x90, 0x78, 0xc1, 0x2b, 0x1a, 0x89, 0xe9...
    {{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0x91, 0x19, 0x21, 0x39, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff...
    {{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0x98, 0xeb, 0x9a, 0xb7, 0x6e, 0x84, 0x49, 0x9c, 0x48, 0x3b, 0x3b, 0xf0, 0x62...
    {{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0x9b, 0x77, 0xb7, 0xf2, 0xc7, 0x4d, 0x99, 0xef, 0xce, 0xaa, 0x55, 0x0f, 0x1a...
    {{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0x9b, 0x77, 0xb7, 0xf2, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff...
    {{0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xa2, 0xf5, 0xcd, 0x83, 0x88, 0x16, 0xc1, 0x6c, 0x4f, 0xe8, 0xa1, 0x66, 0x1d...

 view release on metacpan or  search on metacpan

inc/AU/Build.pm  view on Meta::CPAN

use ExtUtils::CppGuess;
use Config;
use Cwd;

my $base = Cwd::cwd;
my $commit = '3e4cd724ea7ac538723a2044878e7af40481fa4b';

sub new {
    my $class = shift;
    my $protobuf_flags = Alien::ProtoBuf->cflags;
    my $protobuf_cxxflags = Alien::ProtoBuf->cxxflags;

 view release on metacpan or  search on metacpan

libuv/include/uv/errno.h  view on Meta::CPAN

#endif

#if defined(ENOTSUP) && !defined(_WIN32)
# define UV__ENOTSUP UV__ERR(ENOTSUP)
#else
# define UV__ENOTSUP (-4049)
#endif

#if defined(EPERM) && !defined(_WIN32)
# define UV__EPERM UV__ERR(EPERM)
#else
# define UV__EPERM (-4048)
#endif

#if defined(EPIPE) && !defined(_WIN32)
# define UV__EPIPE UV__ERR(EPIPE)
#else
# define UV__EPIPE (-4047)
#endif

#if defined(EPROTO) && !defined(_WIN32)
# define UV__EPROTO UV__ERR(EPROTO)
#else
# define UV__EPROTO UV__ERR(4046)
#endif

#if defined(EPROTONOSUPPORT) && !defined(_WIN32)
# define UV__EPROTONOSUPPORT UV__ERR(EPROTONOSUPPORT)
#else
# define UV__EPROTONOSUPPORT (-4045)
#endif

#if defined(EPROTOTYPE) && !defined(_WIN32)
# define UV__EPROTOTYPE UV__ERR(EPROTOTYPE)
#else
# define UV__EPROTOTYPE (-4044)
#endif

#if defined(EROFS) && !defined(_WIN32)
# define UV__EROFS UV__ERR(EROFS)
#else
# define UV__EROFS (-4043)
#endif

#if defined(ESHUTDOWN) && !defined(_WIN32)
# define UV__ESHUTDOWN UV__ERR(ESHUTDOWN)
#else
# define UV__ESHUTDOWN (-4042)
#endif

#if defined(ESPIPE) && !defined(_WIN32)
# define UV__ESPIPE UV__ERR(ESPIPE)
#else
# define UV__ESPIPE (-4041)
#endif

#if defined(ESRCH) && !defined(_WIN32)
# define UV__ESRCH UV__ERR(ESRCH)
#else
# define UV__ESRCH (-4040)
#endif

#if defined(ETIMEDOUT) && !defined(_WIN32)
# define UV__ETIMEDOUT UV__ERR(ETIMEDOUT)
#else

 view release on metacpan or  search on metacpan

inc/inc_File-Fetch/File/Fetch.pm  view on Meta::CPAN

        ) {
            return $self->_error(loc("Command failed: %1", $captured || ''));
        }

        ### print to local file ###
        ### XXX on a 404 with a special error page, $captured will actually
        ### hold the contents of that page, and make it *appear* like the
        ### request was a success, when really it wasn't :(
        ### there doesn't seem to be an option for lynx to change the exit
        ### code based on a 4XX status or so.
        ### the closest we can come is using --error_file and parsing that,

inc/inc_File-Fetch/File/Fetch.pm  view on Meta::CPAN

=head2 I used 'lynx' to fetch a file, but its contents is all wrong!

C<lynx> can only fetch remote files by dumping its contents to C<STDOUT>,
which we in turn capture. If that content is a 'custom' error file
(like, say, a C<404 handler>), you will get that contents instead.

Sadly, C<lynx> doesn't support any options to return a different exit
code on non-C<200 OK> status, giving us no way to tell the difference
between a 'successfull' fetch and a custom error page.

 view release on metacpan or  search on metacpan

t/test.fa  view on Meta::CPAN

AAATTCATTTACCAAACTGAAATACCATTCTTTGTATTTAAATAAATTATTACTTTATGATGTTTTTAAT
CTTTAAACTGCTTTTGGATGGTGGGCATCCTACACTTAACTCCATGAATGAGGCTAAAGGACAGCCCATC
GAAAGTCACCTAACTCAGGAATAAATAACACCTAGATGTCACATTCCTCATGTTACTTACTAGATTTACT
TCTTCTATATTGAAGAAAATCTCCATAGTGATTATGAA

>gb|AC138731.4| Pongo pygmaeus clone CH253-404N12, complete sequence
ATTGAAAAAATCTTGGTTGGTTTTGATAAAAATCAAATGAATAATTGCTTCTCATTATCATATCAGAAAT
GCAGATGCACGTTTGGTTGACAAAACACACTGAATTTGTTAAAATACTTTCTTAGAAAATTCAGTTGCAA
CGTTATAGTACCATCTAAATCACAAAACTTAATTCAGTAATTTCCAAAAATACATTATTAGTGACTGATA
ATTCTGCTGCTTTCCTCTTTTTTTCAACTTCCATTTTAGGTTCAGAATGTACATGTGCAGTGCAGGTGTT
TCACATGGGTAAATTGCATGTTACTGAGGCTTGGGGTACAAATGATCCCATCACCCAGGTAGTGACCATA

 view release on metacpan or  search on metacpan

benchmark/r1.yml  view on Meta::CPAN

--- 
1: 3760-3913,3996-4276,4486-4605,4706-5095,5174-5326,5439-5630,6915-7069,7157-7232,7315-7450,7564-7649,7762-7835,7942-7987,8236-8325,8417-8464,8571-8666,11864-12940,23519-24451,24542-24655,24752-24962,25041-25435,25524-25743,25825-25997,26081-26203,2...

 view release on metacpan or  search on metacpan

t/isw.csv  view on Meta::CPAN

399,100,7,0
400,100,8,0
401,100,8,0
402,100,9,0
403,100,9,0
404,100,10,0
405,100,10,0
406,100,11,0
407,100,11,0.01
408,100,12,0
409,100,12,0

 view release on metacpan or  search on metacpan

inc/Capture/Tiny.pm  view on Meta::CPAN

  }
  # restore prior filehandles and shut down tees
  # _debug( "# restoring filehandles ...\n" );
  _open_std( $stash->{old} );
  _close( $_ ) for values %{$stash->{old}}; # don't leak fds
  # shouldn't need relayering originals, but see rt.perl.org #114404
  _relayer(\*STDOUT, $layers{stdout}) if $do_stdout;
  _relayer(\*STDERR, $layers{stderr}) if $do_stderr;
  _unproxy( %proxy_std );
  # _debug( "# killing tee subprocesses ...\n" ) if $do_tee;
  _kill_tees( $stash ) if $do_tee;