Result:
found more than 870 distributions - search limited to the first 2001 files matching your query ( run in 1.559 )


Bio-WebService-LANL-SequenceLocator

 view release on metacpan or  search on metacpan

examples/rest.pl  view on Meta::CPAN

        sequence => "TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG",
    ],
);
unless ($response->is_success) {
    die "Request failed: ", $response->status_line, "\n",
        $response->decoded_content;
}
my $results = decode_json( $response->decoded_content );

# $results is now an array ref, like the JSON above
print $results->[0]{polyprotein}, "\n";

 view all matches for this distribution


BioPerl

 view release on metacpan or  search on metacpan

Bio/Tools/Protparam.pm  view on Meta::CPAN


	#Check if successful
	$self->throw("$url error: ".$response->status_line) unless $response->is_success;
	$self->throw("Bad content type at $url ".$response->content_type) unless $response->content_type eq 'text/html';

	my $protParamOutput=$response->decoded_content;

	$self->{'output'}=$protParamOutput;

	return bless $self,$class;

 view all matches for this distribution


BitTorrent-Simple

 view release on metacpan or  search on metacpan

script/torrent  view on Meta::CPAN

    unless ($resp->is_success) {
        warn "  Tracker request failed: " . $resp->status_line . "\n";
        return undef;
    }

    my $decoded = eval { bdecode($resp->content) };
    if ($@) {
        warn "  Failed to decode tracker response: $@\n";
        return undef;
    }
    if ($decoded->{'failure reason'}) {
        warn "  Tracker failure: " . $decoded->{'failure reason'} . "\n";
        return undef;
    }
    return $decoded;
}

# ─── Socket I/O ───────────────────────────────────────────────────────────────

sub read_exactly {

 view all matches for this distribution


Bitcoin-Crypto

 view release on metacpan or  search on metacpan

lib/Bitcoin/Crypto/Base58.pm  view on Meta::CPAN


my $CHECKSUM_SIZE = 4;

sub verify_checksum
{
	my ($decoded) = @_;
	my $encoded_val = substr $decoded, 0, -$CHECKSUM_SIZE;
	my $checksum = substr $decoded, -$CHECKSUM_SIZE;
	return unpack('a' . $CHECKSUM_SIZE, hash256($encoded_val)) eq $checksum;
}

signature_for encode_base58 => (
	positional => [ByteStr],

lib/Bitcoin/Crypto/Base58.pm  view on Meta::CPAN


sub decode_base58
{
	my ($base58encoded) = @_;

	my $decoded = decode_b58b($base58encoded);
	Bitcoin::Crypto::Exception::Base58InputFormat->raise(
		'illegal characters in base58 string'
	) unless defined $decoded;

	return $decoded;
}

signature_for decode_base58check => (
	positional => [Str],
);

sub decode_base58check
{
	my ($base58encoded) = @_;

	my $decoded = decode_base58($base58encoded);
	Bitcoin::Crypto::Exception::Base58InputChecksum->raise(
		'incorrect base58check checksum'
	) unless verify_checksum($decoded);

	return substr $decoded, 0, -$CHECKSUM_SIZE;
}

1;

__END__

 view all matches for this distribution


Blitz

 view release on metacpan or  search on metacpan

t/blitzexecute.t  view on Meta::CPAN

    my $response = $client->job_status();
    
    ok(!$response->{error}, 'job_status responds without error');
    ok($response->{ok}, 'no error on success');
    is($response->{_id}, $status->{_id}, 'job id returns correctly');
    is($response->{result}{request}{content}, 'content', 'request content was base64 encoded and decoded');
    is($response->{result}{response}{content}, 'content', 'response content was base64 encoded and decoded');

}

# integer test
{

 view all matches for this distribution


Blockchain-Contract-Solidity-ABI

 view release on metacpan or  search on metacpan

lib/Blockchain/Contract/Solidity/ABI/Decoder.pm  view on Meta::CPAN


=over 4

=back

Returns an array reference containing all decoded values

=head1 AUTHOR

Reginaldo Costa, C<< <refeco at cpan.org> >>

 view all matches for this distribution


Blockchain-Ethereum-ABI

 view release on metacpan or  search on metacpan

lib/Blockchain/Ethereum/ABI/Decoder.pm  view on Meta::CPAN


=over 4

=back

Returns an array reference containing all decoded values

=head1 AUTHOR

Reginaldo Costa <refeco@cpan.org>

 view all matches for this distribution


Blockchain-Ethereum-Keystore

 view release on metacpan or  search on metacpan

lib/Blockchain/Ethereum/Keystore/Keyfile.pm  view on Meta::CPAN


sub import_file {
    my ($self, $file_path, $password) = @_;

    my $content = read_file($file_path);
    my $decoded = $self->_json->decode(lc $content);

    return $self->_from_object($decoded, $password);
}

sub _from_object {
    my ($self, $object, $password) = @_;

 view all matches for this distribution


Blockchain-Ethereum-RLP

 view release on metacpan or  search on metacpan

lib/Blockchain/Ethereum/RLP.pm  view on Meta::CPAN


    my $tx_params  = ['0x9', '0x4a817c800', '0x5208', '0x3535353535353535353535353535353535353535', '0xde0b6b3a7640000', '0x', '0x1', '0x', '0x'];
    my $encoded = $rlp->encode($params); #ec098504a817c800825208943535353535353535353535353535353535353535880de0b6b3a764000080018080

    my $encoded_tx_params = 'ec098504a817c800825208943535353535353535353535353535353535353535880de0b6b3a764000080018080';
    my $decoded = $rlp->decode(pack "H*", $encoded_tx_params); #['0x9', '0x4a817c800', '0x5208', '0x3535353535353535353535353535353535353535', '0xde0b6b3a7640000', '0x', '0x1', '0x', '0x']

=head1 METHODS

=head2 encode

 view all matches for this distribution


Blockchain-Ethereum-Transaction

 view release on metacpan or  search on metacpan

t/eip1559.t  view on Meta::CPAN

        '02f901c3820539808009831de2b98080b90170608060405234801561001057600080fd5b50610150806100206000396000f3fe608060405234801561001057600080fd5b50600436106100365760003560e01c80632e64cec11461003b5780636057361d14610059575b600080fd5b610043610075565b604...
    );

    my $rlp = Blockchain::Ethereum::RLP->new();
    # substring to remove the 02
    my $decoded = $rlp->decode(substr($raw_transaction, 1));

    is hex $decoded->[-3], 0, 'correct eip155 v value for contract creation transaction';

};

subtest "eth transfer" => sub {
    my $transaction = Blockchain::Ethereum::Transaction::EIP1559->new(

t/eip1559.t  view on Meta::CPAN

        '02f86c820539018009825208943535353535353535353535353535353535353535880de0b6b3a764000080c080a070816c3d026c13a53e98e5dc414398e9dcdf23e440e777114a3e04810e0dfb5da07d732e6b7f847b06d2baed033772d78407da8f4010fa9300df79f2209ba4c7a0'
    );

    my $rlp = Blockchain::Ethereum::RLP->new();
    # substring to remove the 02
    my $decoded = $rlp->decode(substr($raw_transaction, 1));

    is hex $decoded->[-3], 0, 'correct eip155 v value for contract creation transaction';

};

done_testing;

 view all matches for this distribution


Blockchain-Ethereum

 view release on metacpan or  search on metacpan

lib/Blockchain/Ethereum/ABI/Decoder.pm  view on Meta::CPAN


=over 4

=back

Returns an array reference containing all decoded values

=head1 AUTHOR

REFECO <refeco@cpan.org>

 view all matches for this distribution


BlueCoat-SGOS

 view release on metacpan or  search on metacpan

t/sysinfos/ProxySG-4006060000--20090307-165730UTC.sysinfo  view on Meta::CPAN

      (summary)
    )
  )
  (exception.content_encoding_error
    (contact)
    (details "Server response could not be decoded using encoding type returned by server.")
    (format)
    (help "This is typically caused by a Web Site presenting a content encoding header of one type, and then encoding the data differently.")
    (summary "Content Encoding Error")
    (http
      (code "502")

 view all matches for this distribution


Bluesky-Poster

 view release on metacpan or  search on metacpan

lib/Bluesky/Poster.pm  view on Meta::CPAN

		}),
	);

	unless ($res->is_success) {
		if(my $logger = $self->{'logger'}) {
			$logger->error('Login failed: ', $res->status_line, "\n", $res->decoded_content());
		}
		croak('Login failed: ', $res->status_line, "\n", $res->decoded_content());
	}

	$self->{session} = $self->{json}->decode($res->decoded_content);
}

=head2 post($text)

Posts the given text to your Bluesky feed.

lib/Bluesky/Poster.pm  view on Meta::CPAN

		Content => $self->{json}->encode($payload),
	);

	unless ($res->is_success) {
		if(my $logger = $self->{'logger'}) {
			$logger->error('Post failed: ' . $res->status_line . "\n" . $res->decoded_content());
		}
		croak('Post failed: ', $res->status_line, "\n", $res->decoded_content());
	}

	return $self->{json}->decode($res->decoded_content);
}

sub _iso8601 {
	my $t = $_[0];
	my @gmt = gmtime($t);

 view all matches for this distribution


BmltClient-ApiClient

 view release on metacpan or  search on metacpan

lib/BmltClient/ApiClient.pm  view on Meta::CPAN

        return undef;
    } elsif ( (substr($class, 0, 5)) eq 'HASH[') { #hash
        if ($class =~ /^HASH\[(.*),(.*)\]$/) {
            my ($key_type, $type) = ($1, $2);
            my %hash;
            my $decoded_data = decode_json $data;
            foreach my $key (keys %$decoded_data) {
                if (ref $decoded_data->{$key} eq 'HASH') {
                    $hash{$key} = $self->deserialize($type, encode_json $decoded_data->{$key});
                } else {
                    $hash{$key} = $self->deserialize($type, $decoded_data->{$key});
                }
            }
            return \%hash;
        } else {
          #TODO log error

 view all matches for this distribution


Bot-Babelfish

 view release on metacpan or  search on metacpan

lib/Bot/Babelfish.pm  view on Meta::CPAN

=item non_unicode_version()

This function returns a printable version of the given string 
(with a European value of "printable" C<:-)>. More precisely, 
if the string only contains Latin-1 characters, it is returned 
decoded from internal Perl format. If the string contains 
others characters outside Latin-1, it's converted using 
C<Text::Unidecode>. 

=cut

 view all matches for this distribution


Bot-BasicBot

 view release on metacpan or  search on metacpan

lib/Bot/BasicBot.pm  view on Meta::CPAN

        }
        else {
            push @r, decode_irc($_);
        }
    }
    #warn Dumper({ decoded => \@r });
    return @r;
}

sub charset_encode {
    my $self = shift;

 view all matches for this distribution


Bot-Cobalt-Plugin-YouTube

 view release on metacpan or  search on metacpan

lib/Bot/Cobalt/Plugin/YouTube.pm  view on Meta::CPAN


  logger->debug("youtube_plug_resp_recv for $req_url");

  return PLUGIN_EAT_ALL unless $response->is_success;

  my $content = $response->decoded_content;

  my $html = HTML::TokeParser->new( \$content );

  my ($title, $short_url);

 view all matches for this distribution


Bot-Cobalt

 view release on metacpan or  search on metacpan

lib/Bot/Cobalt/IRC/Event/Topic.pm  view on Meta::CPAN

This is the L<Bot::Cobalt::IRC::Event::Channel> subclass for channel topic 
changes.

=head2 topic

Returns the new channel topic, as an (undecoded and non-stripped) 
string.

=head2 stripped

Returns the color- and formatting-stripped topic string.

 view all matches for this distribution


Bot-IRC-X-Feeds

 view release on metacpan or  search on metacpan

lib/Bot/IRC/X/Feeds.pm  view on Meta::CPAN

            for my $url ( @{ $bot->store->get('urls') || [] } ) {
                my $res = $ua->get( $url->{url} );
                next unless ( $res->is_success );

                eval {
                    $rss->parse( $res->decoded_content );
                };
                if ($@) {
                    warn $@;
                    next;
                }

 view all matches for this distribution


BrandMeister-API

 view release on metacpan or  search on metacpan

lib/BrandMeister/API.pm  view on Meta::CPAN

    my($res) = $ua->request($req);
    print('Request status line: '.$res->status_line."\n") if($self->{DEBUG}) ;
    if (!$res->is_success) {
        return($res->status_line);
    };
    $self->{_JSONRESPONSEREF} = $jsonresobj->decode($res->decoded_content);
    return(0);
};
    

=head2 json_response

 view all matches for this distribution


Brightcove-MAPI

 view release on metacpan or  search on metacpan

lib/Brightcove/MAPI.pm  view on Meta::CPAN

	my $url = URI->new($self->read_api_url);
	$url->query_form(%$params);
	my $res = $self->user_agent->get($url->as_string);

	if ($res->is_success) {
		return decode_json($res->decoded_content);
	} else {
		confess $res->status_line;
	}
}

lib/Brightcove/MAPI.pm  view on Meta::CPAN

			Content => [ json => $jsonrpc ]
		);
	}

	if ($res->is_success) {
		my $content = $res->decoded_content;
		return decode_json($content);
	} else {
		confess $res->status_line;
	}
}

 view all matches for this distribution


Broadworks-OCIP

 view release on metacpan or  search on metacpan

Changes  view on Meta::CPAN

0.08      2018-06-25 17:03:25+01:00 Europe/London
    - Updated for more recent dependancies

0.07      2016-06-30 10:46:21+01:00 Europe/London
    - Add role to be consumed by users
    - Ensured that data is decoded on receive

0.06      2016-04-22 14:45:38+01:00 Europe/London
    - Updated to Broadworks Release 20 SP1

0.05      2015-10-19 11:09:00+01:00 Europe/London

 view all matches for this distribution


Browsermob-Proxy

 view release on metacpan or  search on metacpan

lib/Browsermob/Server.pm  view on Meta::CPAN

    my $self = shift;
    my $ua = $self->ua;

    my $res = $ua->get('http://' . $self->server_addr . ':' . $self->server_port . '/proxy');
    if ($res->is_success) {
        my $list = from_json($res->decoded_content)->{proxyList};

        my @proxies = map {
            $_->{port};
        } @$list;

 view all matches for this distribution


Build-PPK

 view release on metacpan or  search on metacpan

share/stub.pl  view on Meta::CPAN

    }

    close $out;

    while ( my $len = read( DATA, my $buf, 4081 ) ) {
        my $decoded = MIME::Base64::decode_base64($buf);

        syswrite( $in, $decoded ) or die("Failed to syswrite(): $!");
    }

    close $in;

    waitpid( $pid, 0 );

 view all matches for this distribution


Bundle-WATERKIP

 view release on metacpan or  search on metacpan

lib/Bundle/WATERKIP/CLI/Azure/Password.pm  view on Meta::CPAN

  my $ua = LWP::UserAgent->new();
  $ua->default_header("Authorization", "Bearer $token");

  my $res = $ua->get($self->_cli_args->{use_at});
  if($res->is_success) {
      say $res->decoded_content;
      return;
  }
  say $token;
  die $res->status_line;

 view all matches for this distribution


Business-BR-CNJ-NumberExtractor

 view release on metacpan or  search on metacpan

lib/Business/BR/CNJ/NumberExtractor.pm  view on Meta::CPAN


 die $req->status_line if !$req->is_success;

 # text/html
 if ( $req->header( 'Content-type' ) eq 'text/html' ) {
  my $dom = Mojo::DOM->new( $req->decoded_content );

  return cnj_extract_numbers( $dom->all_text );

 # Everything else
 } else {
  return cnj_extract_numbers( $req->decoded_content );
 }

}

1;

 view all matches for this distribution


Business-Bitcoin

 view release on metacpan or  search on metacpan

lib/Business/Bitcoin/Request.pm  view on Meta::CPAN

}

sub _decode58 {
  my $todecode = shift;
  $todecode =~ tr/A-HJ-NP-Za-km-z/a-km-zA-HJ-NP-Z/;
  my $decoded = decode_base58($todecode);
}

sub _encode58 {
  my $encoded = encode_base58(shift);
  $encoded =~ tr/a-km-zA-HJ-NP-Z/A-HJ-NP-Za-km-z/;

 view all matches for this distribution


Business-Bitpay

 view release on metacpan or  search on metacpan

lib/Business/Bitpay.pm  view on Meta::CPAN


    my $http_response = $self->{ua}->request($self->prepare_request(@_));
    Carp::croak($http_response->status_line)
      unless $http_response->is_success;

    my $response = decode_json($http_response->decoded_content);

    if (my $error = $response->{error}) {
        my $messages = $error->{messages};
        Carp::croak("$error->{message}: ",
            join(', ', map {"$_ ($messages->{$_})"} keys %$messages));

 view all matches for this distribution


Business-CPI-Gateway-PayPal

 view release on metacpan or  search on metacpan

lib/Business/CPI/Gateway/PayPal/IPN.pm  view on Meta::CPAN

has is_valid => (
    is      => 'lazy',
    default => sub {
        my $self = shift;

        for ($self->response->decoded_content) {
            return 0 if /^INVALID$/;
            return 1 if /^VERIFIED$/;

            die "Vague response: " . $_;
        }

 view all matches for this distribution


Business-DK-Postalcode

 view release on metacpan or  search on metacpan

bin/postdanmark.pl  view on Meta::CPAN

my $ua = LWP::UserAgent->new;

my $response = $ua->get($url);

if ( $response->is_success ) {
    my $content = $response->decoded_content;

    my $ctx = Digest::MD5->new;

    $ctx->add($content);
    my $digest = $ctx->hexdigest;

 view all matches for this distribution


( run in 1.559 second using v1.01-cache-2.11-cpan-0b5f733616e )