Result:
found more than 950 distributions - search limited to the first 2001 files matching your query ( run in 1.790 )


Bio-BigFile

 view release on metacpan or  search on metacpan

lib/Bio/DB/BigWigSet.pm  view on Meta::CPAN

    unless ($response->is_success) {
	warn "Web fetch of $dir failed: ",$response->status_line;
	return;
    }

    my $html = $response->decoded_content;
    my $base = $response->base;
    my @wigfiles = map {URI::URL->new($_=>$base)->abs} $html =~ /href="([^\"]+\.bw)"/ig;
    my @indices  = map {URI::URL->new($_=>$base)->abs} $html =~ /href="(meta[^\"]*)"/ig;
    return (\@wigfiles,\@indices);
}

lib/Bio/DB/BigWigSet.pm  view on Meta::CPAN

	my $r  = $ua->get($file);
	die "Couldn't read $file: ",$r->status_line unless $r->is_success;
	eval "require IO::String; 1" 
	    or die "IO::String module is required for remote directories"
	    unless IO::String->can('new');
	$f = IO::String->new($r->decoded_content);
    }
    else {
	$f = IO::File->new($file) or die "$file: $!";
    }
    my ($current_path,%wigs);

 view all matches for this distribution


Bio-BioVeL

 view release on metacpan or  search on metacpan

lib/Bio/BioVeL/Service.pm  view on Meta::CPAN

	# location is a URL
	if ( $location =~ m#^(?:http|ftp|https)://# ) {
		my $ua = LWP::UserAgent->new;
		my $response = $ua->get($location);
		if ( $response->is_success ) {
			my $content = $response->decoded_content;
			open my $fh, '<', \$content;
			return $fh;
		}
	}
	else {

 view all matches for this distribution


Bio-EBI-RNAseqAPI

 view release on metacpan or  search on metacpan

lib/Bio/EBI/RNAseqAPI.pm  view on Meta::CPAN

    my $response = $userAgent->get( $url );

    # If the request was successful, return the parsed JSON.
    if( $response->is_success ) {

        return parse_json( $response->decoded_content );
    }
    # Otherwise, log an error and return undef.
    else {
        
        $logger->error(

 view all matches for this distribution


Bio-EnsEMBL

 view release on metacpan or  search on metacpan

lib/Bio/EnsEMBL/Utils/Net.pm  view on Meta::CPAN

  my ($url) = @_;
  throw "Cannot perform action as LWP::UserAgent is not available" unless $LWP;
  my $ua = LWP::UserAgent->new();
  $ua->env_proxy;
  my $response = $ua->get($url);
  return $response->decoded_content if $response->is_success;
  return;
}

sub _get_lwp_to_file {
  my ($url, $filename) = @_;

 view all matches for this distribution


Bio-KBase

 view release on metacpan or  search on metacpan

scripts/get_abundance_profile  view on Meta::CPAN

if ($res->is_success){

  if ($res->header('Content-Type') eq "application/json") {
    
    my $json = JSON->new->allow_nonref;
    my $biom = $json->decode( $res->decoded_content ); 
   
    # transform biom into plain list
    if ($biom->{matrix_type} eq "dense" and $format eq "plain"){

      my $counter = 0;

scripts/get_abundance_profile  view on Meta::CPAN

	$counter++;
	exit if ($debug and $counter == 20) ;
      }
    }
    else{
      print $res->decoded_content , "\n";
    }
  }
  else{
    print $res->decoded_content , "\n";
  }
}


 view all matches for this distribution


Bio-Phylo-CIPRES

 view release on metacpan or  search on metacpan

lib/Bio/Phylo/CIPRES.pm  view on Meta::CPAN

	my $res  = $ua->post( $url . '/job/' . $self->user, $load, @head );
	if ( $res->is_success ) {
	
		# run submission, parse result
		my $status_url;	
		my $result = $res->decoded_content;
		DEBUG $result;
		XML::Twig->new(
			'twig_handlers' => {
				'jobstatus/selfUri/url' => sub { $status_url = $_->text }
			}

lib/Bio/Phylo/CIPRES.pm  view on Meta::CPAN

	my $res  = $ua->get( $url, @head );
	if ( $res->is_success ) {
	
		# post request, fetch result
		my ( $status, $outfiles );
		my $result = $res->decoded_content;
		DEBUG $result;
		XML::Twig->new(
			'twig_handlers' => {
				'jobstatus/resultsUri/url' => sub { $outfiles = $_->text },
				'jobstatus/terminalStage'  => sub { $status   = $_->text }			

lib/Bio/Phylo/CIPRES.pm  view on Meta::CPAN

	my $ua   = $self->ua;
	my @head = $self->headers(0);
	my $res  = $ua->get( $url, @head );
	my %out_url;
	if ( $res->is_success ) {
		my $result = $res->decoded_content;
		DEBUG $result;
		XML::Twig->new(
			'twig_handlers' => {
				'results/jobfiles/jobfile' => sub {
					my $node = $_;

lib/Bio/Phylo/CIPRES.pm  view on Meta::CPAN

		for my $name ( keys %out ) {
			my $location = $out_url{ $name };
			$res = $ua->get( $location, @head );
			if ( $res->is_success ) {
				open my $fh, '>', $out{ $name } or die $!;
				print $fh $res->decoded_content;
			}
			else {
				throw 'NetworkError' => $res->status_line;	
			}
		}		

 view all matches for this distribution


Bio-Phylo

 view release on metacpan or  search on metacpan

lib/Bio/Phylo/NeXML/Entities.pm  view on Meta::CPAN

Bio::Phylo::NeXML::Entities - Functions for dealing with XML entities

=head1 DESCRIPTION

This package provides subroutines for dealing with characters that need to be
encoded as XML entities, and decoded in other formats. For example: C<&> needs
to be encoded as C<&amp;> in XML. The subroutines have the same signatures and
the same names as those in the commonly-used module L<HTML::Entities>. They are
re-implemented here to avoid introducing dependencies.

=head1 SUBROUTINES

lib/Bio/Phylo/NeXML/Entities.pm  view on Meta::CPAN


Decodes XML entities into the characters they code for

 Type    : Utility function
 Title   : decode_entities
 Usage   : my $decoded = decode_entities('string with &amp; or &gt;')
 Function: decodes encoded entities in argument string(s)
 Returns : Array of decoded strings
 Args    : One or more encoded strings

=back

=head1 SEE ALSO

 view all matches for this distribution


Bio-PhyloTastic

 view release on metacpan or  search on metacpan

lib/Bio/PhyloTastic/DateLife.pm  view on Meta::CPAN

	my $response = $ua->get($url);
	if ( $response->is_success ) {
		$log->info("success: " . $response->status_line);
		
		# read result, this should be a single number 
		my $age = $response->decoded_content;
		chomp($age);
		if ( looks_like_number $age ) {
			$log->info("age: $age");
			return $age;
		}

 view all matches for this distribution


Bio-Polloc

 view release on metacpan or  search on metacpan

lib/Bio/Polloc/LocusIO/gff3.pm  view on Meta::CPAN


The value to decode (str)

=head3 Returns

The decoded value (str)

=cut

sub _gff3_decode {
   my($self,$value) = @_;

 view all matches for this distribution


Bio-WebService-LANL-SequenceLocator

 view release on metacpan or  search on metacpan

examples/rest.pl  view on Meta::CPAN

        sequence => "TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG",
    ],
);
unless ($response->is_success) {
    die "Request failed: ", $response->status_line, "\n",
        $response->decoded_content;
}
my $results = decode_json( $response->decoded_content );

# $results is now an array ref, like the JSON above
print $results->[0]{polyprotein}, "\n";

 view all matches for this distribution


BioPerl

 view release on metacpan or  search on metacpan

Bio/Tools/Protparam.pm  view on Meta::CPAN


	#Check if successful
	$self->throw("$url error: ".$response->status_line) unless $response->is_success;
	$self->throw("Bad content type at $url ".$response->content_type) unless $response->content_type eq 'text/html';

	my $protParamOutput=$response->decoded_content;

	$self->{'output'}=$protParamOutput;

	return bless $self,$class;

 view all matches for this distribution


Bitcoin-Crypto

 view release on metacpan or  search on metacpan

lib/Bitcoin/Crypto/Base58.pm  view on Meta::CPAN


my $CHECKSUM_SIZE = 4;

sub verify_checksum
{
	my ($decoded) = @_;
	my $encoded_val = substr $decoded, 0, -$CHECKSUM_SIZE;
	my $checksum = substr $decoded, -$CHECKSUM_SIZE;
	return unpack('a' . $CHECKSUM_SIZE, hash256($encoded_val)) eq $checksum;
}

signature_for encode_base58 => (
	positional => [ByteStr],

lib/Bitcoin/Crypto/Base58.pm  view on Meta::CPAN


sub decode_base58
{
	my ($base58encoded) = @_;

	my $decoded = decode_b58b($base58encoded);
	Bitcoin::Crypto::Exception::Base58InputFormat->raise(
		'illegal characters in base58 string'
	) unless defined $decoded;

	return $decoded;
}

signature_for decode_base58check => (
	positional => [Str],
);

sub decode_base58check
{
	my ($base58encoded) = @_;

	my $decoded = decode_base58($base58encoded);
	Bitcoin::Crypto::Exception::Base58InputChecksum->raise(
		'incorrect base58check checksum'
	) unless verify_checksum($decoded);

	return substr $decoded, 0, -$CHECKSUM_SIZE;
}

1;

__END__

 view all matches for this distribution


Blitz

 view release on metacpan or  search on metacpan

t/blitzexecute.t  view on Meta::CPAN

    my $response = $client->job_status();
    
    ok(!$response->{error}, 'job_status responds without error');
    ok($response->{ok}, 'no error on success');
    is($response->{_id}, $status->{_id}, 'job id returns correctly');
    is($response->{result}{request}{content}, 'content', 'request content was base64 encoded and decoded');
    is($response->{result}{response}{content}, 'content', 'response content was base64 encoded and decoded');

}

# integer test
{

 view all matches for this distribution


Blockchain-Contract-Solidity-ABI

 view release on metacpan or  search on metacpan

lib/Blockchain/Contract/Solidity/ABI/Decoder.pm  view on Meta::CPAN


=over 4

=back

Returns an array reference containing all decoded values

=head1 AUTHOR

Reginaldo Costa, C<< <refeco at cpan.org> >>

 view all matches for this distribution


Blockchain-Ethereum-ABI

 view release on metacpan or  search on metacpan

lib/Blockchain/Ethereum/ABI/Decoder.pm  view on Meta::CPAN


=over 4

=back

Returns an array reference containing all decoded values

=head1 AUTHOR

Reginaldo Costa <refeco@cpan.org>

 view all matches for this distribution


Blockchain-Ethereum-Keystore

 view release on metacpan or  search on metacpan

lib/Blockchain/Ethereum/Keystore/Keyfile.pm  view on Meta::CPAN


sub import_file {
    my ($self, $file_path, $password) = @_;

    my $content = read_file($file_path);
    my $decoded = $self->_json->decode(lc $content);

    return $self->_from_object($decoded, $password);
}

sub _from_object {
    my ($self, $object, $password) = @_;

 view all matches for this distribution


Blockchain-Ethereum-RLP

 view release on metacpan or  search on metacpan

lib/Blockchain/Ethereum/RLP.pm  view on Meta::CPAN


    my $tx_params  = ['0x9', '0x4a817c800', '0x5208', '0x3535353535353535353535353535353535353535', '0xde0b6b3a7640000', '0x', '0x1', '0x', '0x'];
    my $encoded = $rlp->encode($params); #ec098504a817c800825208943535353535353535353535353535353535353535880de0b6b3a764000080018080

    my $encoded_tx_params = 'ec098504a817c800825208943535353535353535353535353535353535353535880de0b6b3a764000080018080';
    my $decoded = $rlp->decode(pack "H*", $encoded_tx_params); #['0x9', '0x4a817c800', '0x5208', '0x3535353535353535353535353535353535353535', '0xde0b6b3a7640000', '0x', '0x1', '0x', '0x']

=head1 METHODS

=head2 encode

 view all matches for this distribution


Blockchain-Ethereum-Transaction

 view release on metacpan or  search on metacpan

t/eip1559.t  view on Meta::CPAN

        '02f901c3820539808009831de2b98080b90170608060405234801561001057600080fd5b50610150806100206000396000f3fe608060405234801561001057600080fd5b50600436106100365760003560e01c80632e64cec11461003b5780636057361d14610059575b600080fd5b610043610075565b604...
    );

    my $rlp = Blockchain::Ethereum::RLP->new();
    # substring to remove the 02
    my $decoded = $rlp->decode(substr($raw_transaction, 1));

    is hex $decoded->[-3], 0, 'correct eip155 v value for contract creation transaction';

};

subtest "eth transfer" => sub {
    my $transaction = Blockchain::Ethereum::Transaction::EIP1559->new(

t/eip1559.t  view on Meta::CPAN

        '02f86c820539018009825208943535353535353535353535353535353535353535880de0b6b3a764000080c080a070816c3d026c13a53e98e5dc414398e9dcdf23e440e777114a3e04810e0dfb5da07d732e6b7f847b06d2baed033772d78407da8f4010fa9300df79f2209ba4c7a0'
    );

    my $rlp = Blockchain::Ethereum::RLP->new();
    # substring to remove the 02
    my $decoded = $rlp->decode(substr($raw_transaction, 1));

    is hex $decoded->[-3], 0, 'correct eip155 v value for contract creation transaction';

};

done_testing;

 view all matches for this distribution


Blockchain-Ethereum

 view release on metacpan or  search on metacpan

lib/Blockchain/Ethereum/ABI/Decoder.pm  view on Meta::CPAN


=over 4

=back

Returns an array reference containing all decoded values

=head1 AUTHOR

REFECO <refeco@cpan.org>

 view all matches for this distribution


BlueCoat-SGOS

 view release on metacpan or  search on metacpan

t/sysinfos/ProxySG-4006060000--20090307-165730UTC.sysinfo  view on Meta::CPAN

      (summary)
    )
  )
  (exception.content_encoding_error
    (contact)
    (details "Server response could not be decoded using encoding type returned by server.")
    (format)
    (help "This is typically caused by a Web Site presenting a content encoding header of one type, and then encoding the data differently.")
    (summary "Content Encoding Error")
    (http
      (code "502")

 view all matches for this distribution


Bluesky-Poster

 view release on metacpan or  search on metacpan

lib/Bluesky/Poster.pm  view on Meta::CPAN

		}),
	);

	unless ($res->is_success) {
		if(my $logger = $self->{'logger'}) {
			$logger->error('Login failed: ', $res->status_line, "\n", $res->decoded_content());
		}
		croak('Login failed: ', $res->status_line, "\n", $res->decoded_content());
	}

	$self->{session} = $self->{json}->decode($res->decoded_content);
}

=head2 post($text)

Posts the given text to your Bluesky feed.

lib/Bluesky/Poster.pm  view on Meta::CPAN

		Content => $self->{json}->encode($payload),
	);

	unless ($res->is_success) {
		if(my $logger = $self->{'logger'}) {
			$logger->error('Post failed: ' . $res->status_line . "\n" . $res->decoded_content());
		}
		croak('Post failed: ', $res->status_line, "\n", $res->decoded_content());
	}

	return $self->{json}->decode($res->decoded_content);
}

sub _iso8601 {
	my $t = $_[0];
	my @gmt = gmtime($t);

 view all matches for this distribution


BmltClient-ApiClient

 view release on metacpan or  search on metacpan

lib/BmltClient/ApiClient.pm  view on Meta::CPAN

        return undef;
    } elsif ( (substr($class, 0, 5)) eq 'HASH[') { #hash
        if ($class =~ /^HASH\[(.*),(.*)\]$/) {
            my ($key_type, $type) = ($1, $2);
            my %hash;
            my $decoded_data = decode_json $data;
            foreach my $key (keys %$decoded_data) {
                if (ref $decoded_data->{$key} eq 'HASH') {
                    $hash{$key} = $self->deserialize($type, encode_json $decoded_data->{$key});
                } else {
                    $hash{$key} = $self->deserialize($type, $decoded_data->{$key});
                }
            }
            return \%hash;
        } else {
          #TODO log error

 view all matches for this distribution


Bot-Babelfish

 view release on metacpan or  search on metacpan

lib/Bot/Babelfish.pm  view on Meta::CPAN

=item non_unicode_version()

This function returns a printable version of the given string 
(with a European value of "printable" C<:-)>. More precisely, 
if the string only contains Latin-1 characters, it is returned 
decoded from internal Perl format. If the string contains 
others characters outside Latin-1, it's converted using 
C<Text::Unidecode>. 

=cut

 view all matches for this distribution


Bot-BasicBot

 view release on metacpan or  search on metacpan

lib/Bot/BasicBot.pm  view on Meta::CPAN

        }
        else {
            push @r, decode_irc($_);
        }
    }
    #warn Dumper({ decoded => \@r });
    return @r;
}

sub charset_encode {
    my $self = shift;

 view all matches for this distribution


Bot-Cobalt-Plugin-YouTube

 view release on metacpan or  search on metacpan

lib/Bot/Cobalt/Plugin/YouTube.pm  view on Meta::CPAN


  logger->debug("youtube_plug_resp_recv for $req_url");

  return PLUGIN_EAT_ALL unless $response->is_success;

  my $content = $response->decoded_content;

  my $html = HTML::TokeParser->new( \$content );

  my ($title, $short_url);

 view all matches for this distribution


Bot-Cobalt

 view release on metacpan or  search on metacpan

lib/Bot/Cobalt/IRC/Event/Topic.pm  view on Meta::CPAN

This is the L<Bot::Cobalt::IRC::Event::Channel> subclass for channel topic 
changes.

=head2 topic

Returns the new channel topic, as an (undecoded and non-stripped) 
string.

=head2 stripped

Returns the color- and formatting-stripped topic string.

 view all matches for this distribution


Bot-IRC-X-Feeds

 view release on metacpan or  search on metacpan

lib/Bot/IRC/X/Feeds.pm  view on Meta::CPAN

            for my $url ( @{ $bot->store->get('urls') || [] } ) {
                my $res = $ua->get( $url->{url} );
                next unless ( $res->is_success );

                eval {
                    $rss->parse( $res->decoded_content );
                };
                if ($@) {
                    warn $@;
                    next;
                }

 view all matches for this distribution


BrandMeister-API

 view release on metacpan or  search on metacpan

lib/BrandMeister/API.pm  view on Meta::CPAN

    my($res) = $ua->request($req);
    print('Request status line: '.$res->status_line."\n") if($self->{DEBUG}) ;
    if (!$res->is_success) {
        return($res->status_line);
    };
    $self->{_JSONRESPONSEREF} = $jsonresobj->decode($res->decoded_content);
    return(0);
};
    

=head2 json_response

 view all matches for this distribution


Brightcove-MAPI

 view release on metacpan or  search on metacpan

lib/Brightcove/MAPI.pm  view on Meta::CPAN

	my $url = URI->new($self->read_api_url);
	$url->query_form(%$params);
	my $res = $self->user_agent->get($url->as_string);

	if ($res->is_success) {
		return decode_json($res->decoded_content);
	} else {
		confess $res->status_line;
	}
}

lib/Brightcove/MAPI.pm  view on Meta::CPAN

			Content => [ json => $jsonrpc ]
		);
	}

	if ($res->is_success) {
		my $content = $res->decoded_content;
		return decode_json($content);
	} else {
		confess $res->status_line;
	}
}

 view all matches for this distribution


Broadworks-OCIP

 view release on metacpan or  search on metacpan

Changes  view on Meta::CPAN

0.08      2018-06-25 17:03:25+01:00 Europe/London
    - Updated for more recent dependancies

0.07      2016-06-30 10:46:21+01:00 Europe/London
    - Add role to be consumed by users
    - Ensured that data is decoded on receive

0.06      2016-04-22 14:45:38+01:00 Europe/London
    - Updated to Broadworks Release 20 SP1

0.05      2015-10-19 11:09:00+01:00 Europe/London

 view all matches for this distribution


( run in 1.790 second using v1.01-cache-2.11-cpan-9383018d099 )