Bio-DB-TFBS
view release on metacpan or search on metacpan
t/transfac_pro.t view on Meta::CPAN
my %fragment_ids = map { $_ => 1 } $db->get_fragment_ids(-gene => 'G020751');
ok $fragment_ids{'FR0002267'};
# get_reference_ids(-gene => ...) already tested
}
# site.dat
{
ok my ($site_id) = $db->get_site_ids(-id => 'HS$IFI616_01');
is $site_id, 'R00001';
ok my $seq = $db->get_seq($site_id);
isa_ok $seq, 'Bio::Seq';
is $seq->id, 'HS$IFI616_01';
is $seq->accession_number, 'R00001';
is $seq->seq, 'aGAGACATAAGTgA';
my $annot = $seq->annotation;
is [$annot->get_Annotations('relative_start')]->[0]->value, -172;
is [$annot->get_Annotations('relative_end')]->[0]->value, -98;
is [$annot->get_Annotations('relative_type')]->[0]->value, 'TSS';
is [$annot->get_Annotations('relative_to')]->[0]->value, 'G000176';
is $seq->species, 9606;
my @site_ids = $db->get_site_ids(-species => '9606');
is @site_ids, 14;
is [sort @site_ids]->[0], 'R00001';
# get_site_ids(-gene => ...) already tested
($site_id) = $db->get_site_ids(-matrix => 'M00972');
is $site_id, 'R00001';
my %site_ids = map { $_ => 1 } $db->get_site_ids(-factor => 'T00428');
ok $site_ids{R00001};
# get_site_ids(-reference => ...) already tested
# get_gene_ids(-site => ...) already tested
my @matrix_ids = $db->get_matrix_ids(-site => 'R00001');
is "@matrix_ids", 'M00972';
my @factor_ids = $db->get_factor_ids(-site => 'R00001');
is "@factor_ids", 'T00428';
# get_reference_ids(-site => ...) already tested
}
# matrix.dat
{
ok my ($matrix_id) = $db->get_matrix_ids(-id => 'V$E47_01');
is $matrix_id, 'M00002';
ok my $matrix = $db->get_matrix($matrix_id);
isa_ok $matrix, 'Bio::Matrix::PSM::SiteMatrix';
# detailed psm tests
{
# Lets try to compress and uncompress the frequencies, see if
# there is no considerable loss of data.
my $fA = $matrix->get_compressed_freq('A');
my @check = Bio::Matrix::PSM::SiteMatrix::_uncompress_string($fA,1,1);
my @A = $matrix->get_array('A');
my ($var, $max) = (0, 0);
for (my $i = 0; $i < @check; $i++) {
my $diff = abs(abs($check[$i]) - abs($A[$i]));
$var += $diff;
$max = $diff if ($diff > $max);
}
my $avg = $var / @check;
cmp_ok $avg, '<', 0.01; # Loss of data under 1 percent
# SiteMatrixI methods
is $matrix->id, 'V$E47_01';
is $matrix->accession_number, $matrix_id;
is $matrix->consensus, 'ATGCATGCATGC';
is $matrix->IUPAC, 'NNNNNNNNNNNN';
is $matrix->regexp, '\S\S\S\S\S\S\S\S\S\S\S\S';
is $matrix->width, 12;
is $matrix->sites, 5;
ok ! $matrix->IC;
ok ! $matrix->e_val;
}
ok my $aln = $db->get_aln($matrix_id);
isa_ok $aln, 'Bio::SimpleAlign';
is $aln->length, 12;
is $aln->num_residues, 132;
ok $aln->is_flush;
is $aln->num_sequences, 11;
my @ids = qw(R05108 R05109 R05110 R05111 R05112 R05113 R05114 R05115 R05116 R05117 R05118);
foreach my $seq ($aln->each_alphabetically) {
is $seq->id, shift(@ids);
}
is @ids, 0;
ok ! $db->get_aln('M00001'); # no seqs in db
ok $aln = $db->get_aln('M00001', 1); # force to find seqs, store in db
ok $aln = $db->get_aln('M00001'); # seqs now in db
is $aln->num_sequences, 5;
($matrix_id) = $db->get_matrix_ids(-name => 'MyoD');
is $matrix_id, 'M00001';
# get_matrix_ids(-site => ...) already tested
my %matrix_ids = map { $_ => 1 } $db->get_matrix_ids(-factor => 'T00526');
ok $matrix_ids{M00001};
# get_matrix_ids(-reference => ...) already tested
# get_site_ids(-matrix => ...) already tested
my @factor_ids = $db->get_factor_ids(-matrix => 'M00001');
is join(' ', sort @factor_ids), 'T00526 T09177';
# get_reference_ids(-matrix => ...) already tested
}
# fragment.dat
{
ok my ($fragment_id) = $db->get_fragment_ids(-id => 'FR0002267');
is $fragment_id, 'FR0002267'; # id and accession are the same for fragments
ok my $seq = $db->get_fragment($fragment_id);
isa_ok $seq, 'Bio::SeqI';
is $seq->id, 'FR0002267';
is $seq->seq, 'GTCTACAACACTCTTGCGGACGGAGAGCCGAAGAGCAAAGCGTCGCCGGGTAAGACGAACGCTCAAGGGGGTACGAGCAGCGTAACGACGGAAACGGTGACGCCCCGGGATTTGGGGCTCAGCTAGGGTCGCCGAGTAGGGGGCCGCGGGGACAACGGGGGCGACACGCCGCTTTCCCTGCGTCTGTGGAGCCTATGGTACGGCGTAACCGGTTGTGTGATGAACTG...
is $seq->species, 9606;
# -id -species -gene -factor -reference
my @fragment_ids = $db->get_fragment_ids(-species => '9606');
is @fragment_ids, 2;
is [sort @fragment_ids]->[0], 'FR0000001';
my %fragment_ids = map { $_ => 1 } $db->get_fragment_ids(-factor => 'T03828');
ok $fragment_ids{'FR0002267'};
# get_fragment_ids(-gene => ...) already tested
# get_fragment_ids(-reference => ...) already tested
( run in 0.987 second using v1.01-cache-2.11-cpan-364913b4093 )