Bio-WebService-LANL-SequenceLocator
view release on metacpan or search on metacpan
share/about.html view on Meta::CPAN
<!DOCTYPE html>
<html>
<head>
<meta charset="utf-8">
<meta name="viewport" content="width=device-width, initial-scale=1">
<title>HIV Sequence Locator API</title>
<link rel="stylesheet" href="//netdna.bootstrapcdn.com/bootstrap/3.1.1/css/bootstrap.min.css">
<link rel="stylesheet" href="//netdna.bootstrapcdn.com/bootstrap/3.1.1/css/bootstrap-theme.min.css">
<style type="text/css">
code {
color: inherit;
}
.form-inline .form-group {
vertical-align: top;
}
.form-inline .btn {
margin-left: 1em;
}
</style>
</head>
<body>
<div class="container-fluid">
<div class="row">
<div class="col-md-6">
<h1>HIV Sequence Locator API</h1>
<p>
A dead-simple web API for
<a href="http://www.hiv.lanl.gov/content/sequence/LOCATE/locate.html">LANL's HIV sequence locator</a>
providing results in JSON. Positioning, region, and
protein information is all available. Most of the data
presented in the human-readable HTML page is extracted via
this API. Get in touch if you need something that's
missing!
</p>
<h2>Endpoint</h2>
<h3><code>POST .../within/hiv</code></h3>
<p>
Requires one or more values for the POST parameter
<code>sequence</code> <em>or</em> a single-valued
<code>fasta</code> parameter as a URL-encoded string or
file upload of <a href="https://en.wikipedia.org/wiki/FASTA">FASTA</a>-formatted
sequences.
</p>
<p>
Both protein and nucleotide
sequences are accepted, although the data returned varies
by type due to what LANL returns. See the
<a href="#curl">curl example</a> which queries a protein
sequence and the same sequence as nucleotides. If you use
LANL's tool directly, the reverse complements of your
sequences will also be attempted and the best matching
picked; in the interests of reliability and consistency,
this API tells LANL <b>not</b> to reverse complement
sequences. You should instead take care of this before
submitting.
</p>
<p>
Optionally accepts a (<em>highly recommended</em>) <code>base</code>
parameter set to <code>nucleotide</code> or <code>amino
acid</code> which forces all sequences to be interpreted as
the given base type. This is necessary when submitting
sequences with an ambiguous base type due to the overlap in
IUPAC alphabets. In such cases, LANL seems to assume
nucleotides, potentially producing incorrect results. For
example, the amino acid sequence <code>MGGDMKDNW</code> is
also a valid nucleotide sequence, albeit one many ambiguous
bases. Interpreting it as nucleotides, however, is
incorrect. It is not uncommon for short amino acid
peptides to exhibit this property.
</p>
<p>
On success (HTTP 200) the response body is a JSON array
of objects, one per sequence. Both HTTP 4xx and 5xx
status codes are used on failure with plain text bodies
containing an error message.
</p>
<p>
The <code>format</code> parameter may be set to
<code>csv</code> to return comma-separated values partially
representating the full results. <code>format</code> may
also be explicitly set to <code>json</code>, though there is
no need to as JSON is the default and will remain so.
</p>
<table class="table table-condensed">
<thead>
<tr>
<th>HTTP Status</th>
<th>Reason</th>
</tr>
</thead>
<tbody>
<tr>
<td>405 Method Not Allowed</td>
<td>The request did not use the HTTP POST method</td>
</tr>
<tr>
<td>415 Unsupported Media Type</td>
<td>The provided <code>fasta</code> parameter appears to be in the wrong format</td>
</tr>
<tr>
<td>422 Unprocessable Entity</td>
<td>No <code>sequence</code> or <code>fasta</code> parameter was provided, or the parameter did not contain any sequences</td>
</tr>
<tr>
<td>503 Service Unavailable</td>
<td>An unexpected condition occurred while parsing results from LANL</td>
</tr>
<tr>
<td>500 Internal Server Error</td>
<td>An unexpected error occurred while processing your request</td>
</tr>
</tbody>
</table>
<p>
The API tries not to return incorrect data from misparses
of LANL's output. If it detects an anomoly in any of its
parsing stages, it will abort the request and return an
HTTP 503 Service Unavailable. If this happens to your
request, or if you are receiving results you don't expect,
please <a href="mailto:mullspt+cfar@uw.edu">let us know</a>!
</p>
<h2>Quick lookup</h2>
<p>
Submit sequences as a FASTA file and download the location
results as a CSV file. Note that the CSV does not contain
all of the information the API can provide since CSV does
not have standard support for nested or multi-valued data
structures. This form uses the API described above.
</p>
<form action="within/hiv" method="POST" enctype="multipart/form-data" role="form" class="form-inline">
<div class="form-group">
<label for="fasta-upload">FASTA file</label>
<input type="file" id="fasta-upload" name="fasta" style="width: 15em"></label>
</div>
<div class="form-group">
<label><input type="radio" name="base" value="nuc"> Nucleotides</label><br>
<label><input type="radio" name="base" value="aa"> Amino acids</label>
</div>
<input type="hidden" name="format" value="csv">
<button type="submit" class="btn btn-default">Submit</button>
</form>
<hr>
<p>
Created by Thomas Sibley of the
<a href="http://mullinslab.microbiol.washington.edu">Mullins Lab</a>
at the University of Washington, Department of Microbiology.
</p>
<p>
Questions? <a href="mailto:mullspt+cfar@uw.edu">Drop us a line</a>.
</p>
<p>
<a href="https://github.com/MullinsLab/Bio-WebService-LANL-SequenceLocator">Source code</a>
</p>
</div>
<div class="col-md-6">
<h2>Examples</h2>
<a name="curl"></a>
<h3>curl</h3>
<pre>
curl -X POST https://indra.mullins.microbiol.washington.edu/locate-sequence/within/hiv \
--data sequence=SLYNTVAVLYYVHQR \
--data sequence=TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG
</pre>
<pre class="pre-scrollable">
[
{
"query" : "sequence_1",
"query_sequence" : "SLYNTVAVLYYVHQR",
"base_type" : "amino acid",
"reverse_complement" : "0",
"alignment" : "\n Query SLYNTVAVLY YVHQR 15\n :::::::.:: :::: \n HXB2 SLYNTVATLY CVHQR\n\n ",
"hxb2_sequence" : "SLYNTVATLYCVHQR",
"similarity_to_hxb2" : "86.7",
"start" : "77",
"end" : "91",
"genome_start" : "1018",
"genome_end" : "1062",
"polyprotein" : "Gag",
"region_names" : [
"Gag",
"p17"
],
"regions" : [
{
"cds" : "Gag",
"aa_from_cds_start" : [
"229",
"273"
],
"aa_from_polyprotein_start" : null,
"aa_from_protein_start" : [
"77",
( run in 0.822 second using v1.01-cache-2.11-cpan-b16cb0d3907 )