Bio-WebService-LANL-SequenceLocator
view release on metacpan or search on metacpan
lib/Bio/WebService/LANL/SequenceLocator.pm view on Meta::CPAN
print encode_json(\@sequences);
__END__
[
{
"query" : "sequence_1",
"query_sequence" : "AGCAATCAGATGGTCAGCCAAAATTGCCCTATAGTGCAGAACATCCAGGGGCAAGTGGTACATCAGGCCATATCACCTAGAACTTTAAATGCA",
"base_type" : "nucleotide",
"reverse_complement" : "0",
"alignment" : "\n Query AGCAATCAGA TGGTCAGCCA AAATTGCCCT ATAGTGCAGA ACATCCAGGG 50\n :::::::: ::::::::: ::::: :::: :::::::::: :::::::::: \n HXB2 AGCAATCA-- -GGTCAGCCA AAATTACCCT ATAGTGCAGA ACATCCAGGG 1208\n\n Query GCAAGTGGTA CAT...
"hxb2_sequence" : "AGCAATCA---GGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCA",
"similarity_to_hxb2" : "94.6",
"start" : "373",
"end" : "462",
"genome_start" : "1162",
"genome_end" : "1251",
"polyprotein" : "Gag",
"region_names" : [
"Gag",
"p17",
"p24"
],
"regions" : [
{
"cds" : "Gag",
"aa_from_protein_start" : [ "125", "154" ],
"na_from_cds_start" : [ "373", "462" ],
"na_from_hxb2_start" : [ "1162", "1251" ],
"na_from_query_start" : [ "1", "93" ],
"protein_translation" : "SNQMVSQNCPIVQNIQGQVVHQAISPRTLNA"
},
{
"cds" : "p17",
"aa_from_protein_start" : [ "125", "132" ],
"na_from_cds_start" : [ "373", "396" ],
"na_from_hxb2_start" : [ "1162", "1185" ],
"na_from_query_start" : [ "1", "27" ],
"protein_translation" : "SNQMVSQNC"
},
{
"cds" : "p24",
"aa_from_protein_start" : [ "1", "22" ],
"na_from_cds_start" : [ "1", "66" ],
"na_from_hxb2_start" : [ "1186", "1251" ],
"na_from_query_start" : [ "28", "93" ],
"protein_translation" : "PIVQNIQGQVVHQAISPRTLNA"
}
]
}
]
=cut
package Bio::WebService::LANL::SequenceLocator;
use Moo;
use Data::Dumper;
use HTML::LinkExtor;
use HTML::TableExtract;
use HTML::TokeParser;
use HTTP::Request::Common;
use List::AllUtils qw< pairwise part min max >;
our $VERSION = 20170324;
=head1 METHODS
=head2 new
Returns a new instance of this class. An optional parameter C<agent_string>
should be provided to identify yourself to LANL out of politeness. See the
L</SYNOPSIS> for an example.
=cut
has agent_string => (
is => 'ro',
lazy => 1,
builder => sub { '' },
);
has agent => (
is => 'ro',
lazy => 1,
builder => sub {
require LWP::UserAgent;
my $self = shift;
my $agent = LWP::UserAgent->new(
agent => join(" ", __PACKAGE__ . "/$VERSION", $self->agent_string),
);
$agent->env_proxy;
return $agent;
},
);
has lanl_base => (
is => 'ro',
lazy => 1,
builder => sub { 'https://www.hiv.lanl.gov' },
);
has lanl_endpoint => (
is => 'ro',
lazy => 1,
builder => sub { shift->lanl_base . '/cgi-bin/LOCATE/locate.cgi' },
);
has _bogus_slug => (
is => 'ro',
default => sub { 'BOGUS_SEQ_SO_TABULAR_FILES_ARE_LINKED_IN_OUTPUT' },
);
sub _request {
my $self = shift;
my $req = shift;
my $response = $self->agent->request($req);
if (not $response->is_success) {
warn sprintf "Request failed: %s %s -> %s\n",
$req->method, $req->uri, $response->status_line;
return;
( run in 0.577 second using v1.01-cache-2.11-cpan-acf6aa7dc9e )