view release on metacpan or  search on metacpan

lib/Bio/Perl.pm  view on Meta::CPAN

        my $n = ( $scalar =~ tr/ATGCNatgcn/ATGCNatgcn/ );

        if( $n < length($scalar) * 0.85 ) {
            confess("Sequence [$scalar] is less than 85% ATGCN, which doesn't look very DNA to me");
        }

        $obj = Bio::PrimarySeq->new(-id => 'internalbioperlseq',-seq => $scalar);
    }

    return $obj->revcom();
}


sub revcom {
    return &Bio::Perl::reverse_complement(@_);
}



sub reverse_complement_as_string {
    my ($scalar) = shift;
    my $obj = &Bio::Perl::reverse_complement($scalar);
    return $obj->seq;
}



sub revcom_as_string {
    my ($scalar) = shift;
    my $obj = &Bio::Perl::reverse_complement($scalar);
    return $obj->seq;
}


1;


# ABSTRACT: Functional access to BioPerl for people who don't know objects
# AUTHOR: Ewan Birney <birney@ebi.ac.uk>
# OWNER: many people (see the individual modules for their copyright holders)
# LICENSE: Perl_5

__END__

=pod

=encoding UTF-8

=head1 NAME

Bio::Perl - Functional access to BioPerl for people who don't know objects

=head1 VERSION

version 1.7.4

=head1 SYNOPSIS

  use Bio::Perl;

  # will guess file format from extension
  $seq_object = read_sequence($filename);

  # forces genbank format
  $seq_object = read_sequence($filename,'genbank');

  # reads an array of sequences
  @seq_object_array = read_all_sequences($filename,'fasta');

  # sequences are Bio::Seq objects, so the following methods work
  # for more info see Bio::Seq, or do 'perldoc Bio/Seq.pm'

  print "Sequence name is ",$seq_object->display_id,"\n";
  print "Sequence acc  is ",$seq_object->accession_number,"\n";
  print "First 5 bases is ",$seq_object->subseq(1,5),"\n";

  # get the whole sequence as a single string

  $sequence_as_a_string = $seq_object->seq();

  # writing sequences

  write_sequence(">$filename",'genbank',$seq_object);

  write_sequence(">$filename",'genbank',@seq_object_array);

  # making a new sequence from just a string

  $seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA",
      "myname","AL12232");

  # getting a sequence from a database (assumes internet connection)

  $seq_object = get_sequence('swissprot',"ROA1_HUMAN");

  $seq_object = get_sequence('embl',"AI129902");

  $seq_object = get_sequence('genbank',"AI129902");

  # BLAST a sequence (assumes an internet connection)

  $blast_report = blast_sequence($seq_object);

  write_blast(">blast.out",$blast_report);

=head1 DESCRIPTION

Easy first time access to BioPerl via functions.

=head2 read_sequence

 Title   : read_sequence
 Usage   : $seq = read_sequence('sequences.fa')
           $seq = read_sequence($filename,'genbank');

           # pipes are fine
           $seq = read_sequence("my_fetching_program $id |",'fasta');

 Function: Reads the top sequence from the file. If no format is given, it will
           try to guess the format from the filename. If a format is given, it
           forces that format. The filename can be any valid perl open() string
           - in particular, you can put in pipes

 Returns : A Bio::Seq object. A quick synopsis:
           $seq_object->display_id - name of the sequence
           $seq_object->seq        - sequence as a string

 Args    : Two strings, first the filename - any Perl open() string is ok
           Second string is the format, which is optional

For more information on Seq objects see L<Bio::Seq>.

=head2 read_all_sequences

 Title   : read_all_sequences
 Usage   : @seq_object_array = read_all_sequences($filename);
           @seq_object_array = read_all_sequences($filename,'genbank');

 Function: Just as the function above, but reads all the sequences in the
           file and loads them into an array.

           For very large files, you will run out of memory. When this
           happens, you've got to use the SeqIO system directly (this is
           not so hard! Don't worry about it!).

 Returns : array of Bio::Seq objects

 Args    : two strings, first the filename (any open() string is ok)
           second the format (which is optional)

See L<Bio::SeqIO> and L<Bio::Seq> for more information

=head2 write_sequence

 Title   : write_sequence
 Usage   : write_sequence(">new_file.gb",'genbank',$seq)
           write_sequence(">new_file.gb",'genbank',@array_of_sequence_objects)

 Function: writes sequences in the specified format

 Returns : true

 Args    : filename as a string, must provide an open() output file
           format as a string
           one or more sequence objects

=head2 new_sequence

 Title   : new_sequence
 Usage   : $seq_obj = new_sequence("GATTACA", "kino-enzyme");

 Function: Construct a sequency object from sequence string
 Returns : A Bio::Seq object

 Args    : sequence string
           name string (optional, default "no-name-for-sequence")
           accession - accession number (optional, no default)

=head2 blast_sequence