view release on metacpan or  search on metacpan

lib/Bio/Grep/Benchmarks.pod  view on Meta::CPAN

=head1 NAME

Bio::Grep::Benchmarks - Bio::Grep Benchmarks

=head1 DESCRIPTION

A collection of quick and dirty benchmarks. 

=head1 BENCHMARKS

4 x Intel(R) Core(TM)2 Quad CPU Q9400  @ 2.66GHz, 4GB RAM. Fedora Linux 2.6.27.38-170.2.113.fc10.i686.PAE (kernel: 2.6.27.38-170.2.113.fc10.i686.PAE). Perl 5.10.0.0.

TAIR8_cdna_20080412 (Arabidopsis CDNA Fasta file, 63MB). 

Bio::Grep 0.10.6. 

=head2 Database Generation

Average over 2 iterations.

  GUUGle         : 2.88 sec
  Agrep/RE       : 10.69 sec
  Vmatch (-pl 3) : 135.32 sec

  
=head2 Mismatches

Query: C<ugacagaagagagugagcac> (revcom)

Average over 20 iterations.

=over

=item B<No mismatches (exact matching):>

  Vmatch           :  0.02 sec
  Agrep (Wu-Manber):  0.22 sec
  RE               :  1.66 sec
  Vmatch (-online) :  3.80 sec
  GUUGle           :  6.18 sec
  Agrep (TRE)      : 10.22 sec

Note that C<Vmatch> needs one slow run to load the suffix arrays in memory
(Values are the average over 20 iterations). Also note that GUUGle
allows GU mismatches.

=item B<One mismatch:>

  Vmatch           :  0.05 sec
  Agrep (Wu-Manber):  0.98 sec
  Vmatch (-online) :  3.85 sec
  Agrep (TRE)      : 35.26 sec
  GUUGle           :       n/a
  RE               :       n/a

=item B<Two mismatches:>

  Vmatch           :  0.12 sec
  Agrep (Wu-Manber):  1.28 sec
  Vmatch (-online) :  3.89 sec
  Agrep (TRE)      : 43.48 sec
  GUUGle           :       n/a
  RE               :       n/a

=item B<Three mismatches:>

  Vmatch           :  0.28 sec
  Agrep (Wu-Manber):  1.57 sec
  Vmatch (-online) :  4.01 sec
  Agrep (TRE)      : 50.66 sec
  GUUGle           :       n/a
  RE               :       n/a

=item B<Four mismatches:>

  Vmatch           :  0.93 sec
  Agrep (Wu-Manber):  1.89 sec
  Vmatch (-online) :  4.48 sec
  Agrep (TRE)      : 57.43 sec
  GUUGle           :       n/a
  RE               :       n/a

=item B<Five mismatches:>

  Agrep (Wu-Manber):  2.42 sec
  Vmatch           :  3.95 sec
  Vmatch (-online) :  6.85 sec
  Agrep (TRE)      : 64.81 sec
  GUUGle           :       n/a
  RE               :       n/a

=back

=head1 FEEDBACK

The script that generated these benchmarks is available in the I<examples>
directory of this distribution. 

Please report any bugs, feature requests and benchmarks to
C<bug-bio-grep@rt.cpan.org>, or through the web interface at
L<http://rt.cpan.org>. 

=head1 AUTHOR