Bio-Grep
view release on metacpan or search on metacpan
examples/Benchmarks.tt view on Meta::CPAN
=head1 NAME
Bio::Grep::Benchmarks - Bio::Grep Benchmarks
=head1 DESCRIPTION
A collection of quick and dirty benchmarks.
=head1 BENCHMARKS
[% cpuinfo %], 4GB RAM. [% osname %]. Perl [% perl %].
[% filenameCDNA %] (Arabidopsis CDNA Fasta file, 63MB).
Bio::Grep [% biogrepv %].
=head2 Database Generation
Average over [% iterationsdb %] iterations.
GUUGle : [% guugle_dbgen %] sec
Agrep/RE : [% agrep_dbgen %] sec
Vmatch (-pl 3) : [% vmatch_dbgen %] sec
=head2 Mismatches
Query: C<ugacagaagagagugagcac> (revcom)
Average over [% iterations %] iterations.
=over
=item B<No mismatches (exact matching):>
Agrep (Wu-Manber): [% agrep_mm_0_0 %] sec
Vmatch : [% vmatch_mm_0_0 %] sec
RE : [% re_mm_0_0 %] sec
Vmatch (-online) : [% vmatch_mm_0_1 %] sec
GUUGle : [% guugle_mm_0_0 %] sec
Agrep (TRE) : [% agrep_tre_mm_0_0 %] sec
Note that C<Vmatch> needs one slow run to load the suffix arrays in memory
(Values are the average over [% iterations %] iterations). Also note that GUUGle
allows GU mismatches.
=item B<One mismatch:>
Vmatch : [% vmatch_mm_1_0 %] sec
Agrep (Wu-Manber): [% agrep_mm_1_0 %] sec
Vmatch (-online) : [% vmatch_mm_1_1 %] sec
Agrep (TRE) : [% agrep_tre_mm_1_0 %] sec
GUUGle : n/a
RE : n/a
=item B<Two mismatches:>
Vmatch : [% vmatch_mm_2_0 %] sec
Agrep (Wu-Manber): [% agrep_mm_2_0 %] sec
Vmatch (-online) : [% vmatch_mm_2_1 %] sec
Agrep (TRE) : [% agrep_tre_mm_2_0 %] sec
GUUGle : n/a
RE : n/a
=item B<Three mismatches:>
Vmatch : [% vmatch_mm_3_0 %] sec
Agrep (Wu-Manber): [% agrep_mm_3_0 %] sec
Vmatch (-online) : [% vmatch_mm_3_1 %] sec
Agrep (TRE) : [% agrep_tre_mm_3_0 %] sec
GUUGle : n/a
RE : n/a
=item B<Four mismatches:>
Vmatch : [% vmatch_mm_4_0 %] sec
Agrep (Wu-Manber): [% agrep_mm_4_0 %] sec
Vmatch (-online) : [% vmatch_mm_4_1 %] sec
Agrep (TRE) : [% agrep_tre_mm_4_0 %] sec
GUUGle : n/a
RE : n/a
=item B<Five mismatches:>
Agrep (Wu-Manber): [% agrep_mm_5_0 %] sec
Vmatch : [% vmatch_mm_5_0 %] sec
Vmatch (-online) : [% vmatch_mm_5_1 %] sec
Agrep (TRE) : [% agrep_tre_mm_5_0 %] sec
GUUGle : n/a
RE : n/a
=back
=head1 FEEDBACK
The script that generated these benchmarks is available in the I<examples>
directory of this distribution.
Please report any bugs, feature requests and benchmarks to
C<bug-bio-grep@rt.cpan.org>, or through the web interface at
L<http://rt.cpan.org>.
=head1 AUTHOR
( run in 0.513 second using v1.01-cache-2.11-cpan-96521ef73a4 )