Bio-Grep

 view release on metacpan or  search on metacpan

examples/Benchmarks.tt  view on Meta::CPAN

=head1 NAME

Bio::Grep::Benchmarks - Bio::Grep Benchmarks

=head1 DESCRIPTION

A collection of quick and dirty benchmarks. 

=head1 BENCHMARKS

[% cpuinfo %], 4GB RAM. [% osname %]. Perl [% perl %].

[% filenameCDNA %] (Arabidopsis CDNA Fasta file, 63MB). 

Bio::Grep [% biogrepv %]. 

=head2 Database Generation

Average over [% iterationsdb %] iterations.

  GUUGle         : [% guugle_dbgen %] sec
  Agrep/RE       : [% agrep_dbgen  %] sec
  Vmatch (-pl 3) : [% vmatch_dbgen %] sec

  
=head2 Mismatches

Query: C<ugacagaagagagugagcac> (revcom)

Average over [% iterations %] iterations.

=over

=item B<No mismatches (exact matching):>

  Agrep (Wu-Manber):  [%  agrep_mm_0_0 %] sec
  Vmatch           :  [% vmatch_mm_0_0 %] sec
  RE               :  [%     re_mm_0_0 %] sec
  Vmatch (-online) :  [% vmatch_mm_0_1 %] sec
  GUUGle           : [% guugle_mm_0_0 %] sec
  Agrep (TRE)      : [% agrep_tre_mm_0_0 %] sec

Note that C<Vmatch> needs one slow run to load the suffix arrays in memory
(Values are the average over [% iterations %] iterations). Also note that GUUGle
allows GU mismatches.

=item B<One mismatch:>

  Vmatch           :  [% vmatch_mm_1_0 %] sec
  Agrep (Wu-Manber):  [%  agrep_mm_1_0 %] sec
  Vmatch (-online) :  [% vmatch_mm_1_1 %] sec
  Agrep (TRE)      :  [% agrep_tre_mm_1_0 %] sec
  GUUGle           :       n/a
  RE               :       n/a

=item B<Two mismatches:>

  Vmatch           :  [% vmatch_mm_2_0 %] sec
  Agrep (Wu-Manber):  [%  agrep_mm_2_0 %] sec
  Vmatch (-online) :  [% vmatch_mm_2_1 %] sec
  Agrep (TRE)      :  [% agrep_tre_mm_2_0 %] sec
  GUUGle           :       n/a
  RE               :       n/a

=item B<Three mismatches:>

  Vmatch           :  [% vmatch_mm_3_0 %] sec
  Agrep (Wu-Manber):  [%  agrep_mm_3_0 %] sec
  Vmatch (-online) :  [% vmatch_mm_3_1 %] sec
  Agrep (TRE)      :  [% agrep_tre_mm_3_0 %] sec
  GUUGle           :       n/a
  RE               :       n/a

=item B<Four mismatches:>

  Vmatch           :  [% vmatch_mm_4_0 %] sec
  Agrep (Wu-Manber):  [%  agrep_mm_4_0 %] sec
  Vmatch (-online) :  [% vmatch_mm_4_1 %] sec
  Agrep (TRE)      :  [% agrep_tre_mm_4_0 %] sec
  GUUGle           :       n/a
  RE               :       n/a

=item B<Five mismatches:>

  Agrep (Wu-Manber):  [%  agrep_mm_5_0 %] sec
  Vmatch           :  [% vmatch_mm_5_0 %] sec
  Vmatch (-online) :  [% vmatch_mm_5_1 %] sec
  Agrep (TRE)      :  [% agrep_tre_mm_5_0 %] sec
  GUUGle           :       n/a
  RE               :       n/a

=back

=head1 FEEDBACK

The script that generated these benchmarks is available in the I<examples>
directory of this distribution. 

Please report any bugs, feature requests and benchmarks to
C<bug-bio-grep@rt.cpan.org>, or through the web interface at
L<http://rt.cpan.org>. 

=head1 AUTHOR



( run in 1.884 second using v1.01-cache-2.11-cpan-f03e8824b8d )