BioPerl
view release on metacpan or search on metacpan
Bio/Restriction/Analysis.pm view on Meta::CPAN
#
# BioPerl module Bio::Restriction::Analysis
#
# Please direct questions and support issues to <bioperl-l@bioperl.org>
#
# Cared for by Rob Edwards <redwards@utmem.edu>
#
# You may distribute this module under the same terms as perl itself
## POD Documentation:
=head1 NAME
Bio::Restriction::Analysis - cutting sequences with restriction
enzymes
=head1 SYNOPSIS
# analyze a DNA sequence for restriction enzymes
use Bio::Restriction::Analysis;
use Bio::PrimarySeq;
use Data::Dumper;
# get a DNA sequence from somewhere
my $seq = Bio::PrimarySeq->new
(-seq =>'AGCTTAATTCATTAGCTCTGACTGCAACGGGCAATATGTCTC',
-primary_id => 'synopsis',
-molecule => 'dna');
# now start an analysis.
# this is using the default set of enzymes
my $ra = Bio::Restriction::Analysis->new(-seq=>$seq);
# find unique cutters. This returns a
# Bio::Restriction::EnzymeCollection object
my $enzymes = $ra->unique_cutters;
print "Unique cutters: ", join (', ',
map {$_->name} $enzymes->unique_cutters), "\n";
# AluI is one them. Where does it cut?
# This is will return an array of the sequence strings
my $enz = 'AluI';
my @frags = $ra->fragments($enz);
# how big are the fragments?
print "AluI fragment lengths: ", join(' & ', map {length $_} @frags), "\n";
# You can also bypass fragments and call sizes directly:
# to see all the fragment sizes
print "All sizes: ", join " ", $ra->sizes($enz), "\n";
# to see all the fragment sizes sorted by size like on a gel
print "All sizes, sorted ", join (" ", $ra->sizes($enz, 0, 1)), "\n";
# how many times does each enzyme cut
my $cuts = $ra->cuts_by_enzyme('BamHI');
print "BamHI cuts $cuts times\n";
# How many enzymes do not cut at all?
print "There are ", scalar $ra->zero_cutters->each_enzyme,
" enzymes that do not cut\n";
# what about enzymes that cut twice?
my $two_cutters = $ra->cutters(2);
print join (" ", map {$_->name} $two_cutters->each_enzyme),
" cut the sequence twice\n";
# what are all the enzymes that cut, and how often do they cut
printf "\n%-10s%s\n", 'Enzyme', 'Number of Cuts';
my $all_cutters = $ra->cutters;
map {
printf "%-10s%s\n", $_->name, $ra->cuts_by_enzyme($_->name)
} $all_cutters->each_enzyme;
# Finally, we can interact the restriction enzyme object by
# retrieving it from the collection object see the docs for
# Bio::Restriction::Enzyme.pm
my $enzobj = $enzymes->get_enzyme($enz);
=head1 DESCRIPTION
Bio::Restriction::Analysis describes the results of cutting a DNA
sequence with restriction enzymes.
To use this module you can pass a sequence object and optionally a
Bio::Restriction::EnzymeCollection that contains the enzyme(s) to cut the
sequences with. There is a default set of enzymes that will be loaded
if you do not pass in a Bio::Restriction::EnzymeCollection.
To cut a sequence, set up a Restriction::Analysis object with a sequence
like this:
use Bio::Restriction::Analysis;
my $ra = Bio::Restriction::Analysis->new(-seq=>$seqobj);
or
my $ra = Bio::Restriction::Analysis->new
(-seq=>$seqobj, -enzymes=>$enzs);
Then, to get the fragments for a particular enzyme use this:
@fragments = $ra->fragments('EcoRI');
Note that the naming of restriction enzymes is that the last numbers
are usually Roman numbers (I, II, III, etc). You may want to use
something like this:
# get a reference to an array of unique (single) cutters
$singles = $re->unique_cutters;
foreach my $enz ($singles->each_enzyme) {
@fragments = $re->fragments($enz);
... do something here ...
}
Note that if your sequence is circular, the first and last fragment
will be joined so that they are the appropriate length and sequence
for further analysis. This fragment will also be checked for cuts
by the enzyme(s). However, this will change the start of the
sequence!
There are two separate algorithms used depending on whether your
enzyme has ambiguity. The non-ambiguous algorithm is a lot faster,
and if you are using very large sequences you should try and use
this algorithm. If you have a large sequence (e.g. genome) and
want to use ambgiuous enzymes you may want to make separate
Bio::Restriction::Enzyme objects for each of the possible
alternatives and make sure that you do not set is_ambiguous!
This version should correctly deal with overlapping cut sites
in both ambiguous and non-ambiguous enzymes.
I have tried to write this module with speed and memory in mind
so that it can be effectively used for large (e.g. genome sized)
sequence. This module only stores the cut positions internally,
and calculates everything else on an as-needed basis. Therefore
when you call fragment_maps (for example), there may be another
delay while these are generated.
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Support
Please direct usage questions or support issues to the mailing list:
I<bioperl-l@bioperl.org>
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the
web:
https://github.com/bioperl/bioperl-live/issues
=head1 AUTHOR
Rob Edwards, redwards@utmem.edu,
Steve Chervitz, sac@bioperl.org
=head1 CONTRIBUTORS
Heikki Lehvaslaiho, heikki-at-bioperl-dot-org
Mark A. Jensen, maj-at-fortinbras-dot-us
=head1 COPYRIGHT
Copyright (c) 2003 Rob Edwards. Some of this work is Copyright (c)
1997-2002 Steve A. Chervitz. All Rights Reserved.
This module is free software; you can redistribute it and/or modify it
under the same terms as Perl itself.
=head1 SEE ALSO
L<Bio::Restriction::Enzyme>,
L<Bio::Restriction::EnzymeCollection>
=head1 APPENDIX
Methods beginning with a leading underscore are considered private and
are intended for internal use by this module. They are not considered
part of the public interface and are described here for documentation
purposes only.
=cut
package Bio::Restriction::Analysis;
use Bio::Restriction::EnzymeCollection;
use strict;
use Data::Dumper;
use base qw(Bio::Root::Root);
use Scalar::Util qw(blessed);
=head1 new
Title : new
Function : Initializes the restriction enzyme object
Returns : The Restriction::Analysis object
Arguments :
$re_anal->new(-seq=$seqobj,
-enzymes=>Restriction::EnzymeCollection object)
-seq requires a Bio::PrimarySeq object
-enzymes is optional.
If omitted it will use the default set of enzymes
This is the place to start. Pass in a sequence, and you will be able
to get the fragments back out. Several other things are available
like the number of zero cutters or single cutters.
=cut
sub new {
my($class, @args) = @_;
my $self = $class->SUPER::new(@args);
my ($seq,$enzymes) =
$self->_rearrange([qw(
SEQ
ENZYMES
)], @args);
$seq && $self->seq($seq);
$enzymes ? $self->enzymes($enzymes)
: ($self->{'_enzymes'} = Bio::Restriction::EnzymeCollection->new );
# keep track of status
$self->{'_cut'} = 0;
# left these here because we want to reforce a _cut if someone
# just calls new
$self->{maximum_cuts} = 0;
$self->{'_number_of_cuts_by_enzyme'} = {};
$self->{'_number_of_cuts_by_cuts'} = {};
$self->{'_fragments'} = {};
$self->{'_cut_positions'} = {}; # cut position is the real position
$self->{'_frag_map_list'} = {};
return $self;
}
=head1 Methods to set parameters
=cut
=head2 seq
Title : seq
Usage : $ranalysis->seq($newval);
Function : get/set method for the sequence to be cut
Example : $re->seq($seq);
Returns : value of seq
Args : A Bio::PrimarySeqI dna object (optional)
=cut
sub seq {
my $self = shift;
if (@_) {
my $seq = shift;
$self->throw('Need a sequence object ['. ref $seq. ']')
unless $seq->isa('Bio::PrimarySeqI');
$self->throw('Need a DNA sequence object ['. $seq->alphabet. ']')
unless $seq->alphabet eq 'dna';
$self->{'_seq'} = $seq;
$self->{'_cut'} = 0;
}
return $self->{'_seq'};
}
=head2 enzymes
Title : enzymes
Usage : $re->enzymes($newval)
Function : gets/Set the restriction enzyme enzymes
Example : $re->enzymes('EcoRI')
Returns : reference to the collection
Args : an array of Bio::Restriction::EnzymeCollection and/or
Bio::Restriction::Enzyme objects
The default object for this method is
Bio::Restriction::EnzymeCollection. However, you can also pass it a
list of Bio::Restriction::Enzyme objects - even mixed with Collection
objects. They will all be stored into one collection.
=cut
sub enzymes {
my $self = shift;
if (@_) {
$self->{'_enzymes'} = Bio::Restriction::EnzymeCollection->new (-empty => 1)
unless $self->{'_enzymes'};
$self->{'_enzymes'}->enzymes(@_);
$self->{'_cut'} = 0;
Bio/Restriction/Analysis.pm view on Meta::CPAN
return $self->{'_enzymes'};
}
=head1 Perform the analysis
=cut
=head2 cut
Title : cut
Usage : $re->cut()
Function : Cut the sequence with the enzymes
Example : $re->cut(); $re->cut('single'); or $re->cut('multiple', $enzymecollection);
Returns : $self
Args : 'single' (optional), 'multiple' with enzyme collection.
An explicit cut method is needed to pass arguments to it.
There are two varieties of cut. Single is the default, and need
not be explicitly called. This cuts the sequence with each
enzyme separately.
Multiple cuts a sequence with more than one enzyme. You must pass
it a Bio::Restriction::EnzymeCollection object of the set
of enzymes that you want to use in the double digest. The results
will be stored as an enzyme named "multiple_digest", so you can
use all the retrieval methods to get the data.
If you want to use the default setting there is no need to call cut
directly. Every method in the class that needs output checks the
object's internal status and recalculates the cuts if needed.
Note: cut doesn't now re-initialize everything before figuring
out cuts. This is so that you can do multiple digests, or add more
data or whatever. You'll have to use new to reset everything.
See also the comments in above about ambiguous and non-ambiguous
sequences.
=cut
sub cut {
my ($self, $opt, $ec) = @_;
# for the moment I have left this as a separate routine so
# the user calls cut rather than _cuts. This also initializes
# some stuff we need to use.
$self->throw("A sequence must be supplied")
unless $self->seq;
if ($opt && uc($opt) eq "MULTIPLE") {
$self->throw("You must supply a separate enzyme collection for multiple digests") unless $ec;
$self->_multiple_cuts($ec); # multiple digests
} else {
# reset some of the things that we save
$self->{maximum_cuts} = 0;
$self->{'_number_of_cuts_by_enzyme'} = {};
$self->{'_number_of_cuts_by_cuts'} = {};
$self->{'_fragments'} = {};
$self->{'_cut_positions'} = {}; # cut position is the real position
$self->{'_frag_map_list'} = {};
$self->_cuts;
}
$self->{'_cut'} = 1;
return $self;
}
=head2 multiple_digest
Title : multiple_digest
Function : perform a multiple digest on a sequence
Returns : $self so you can go and get any of the other methods
Arguments : An enzyme collection
Multiple digests can use 1 or more enzymes, and the data is stored
in as if it were an enzyme called multiple_digest. You can then
retrieve information about multiple digests from any of the other
methods.
You can use this method in place of $re->cut('multiple', $enz_coll);
=cut
sub multiple_digest {
my ($self, $ec)=@_;
return $self->cut('multiple', $ec);
}
=head1 Query the results of the analysis
=cut
=head2 positions
Title : positions
Function : Retrieve the positions that an enzyme cuts at
Returns : An array of the positions that an enzyme cuts at
: or an empty array if the enzyme doesn't cut
Arguments: An enzyme name to retrieve the positions for
Comments : The cut occurs after the base specified.
=cut
sub positions {
my ($self, $enz) = @_;
$self->cut unless $self->{'_cut'};
$self->throw('no enzyme selected to get positions for')
unless $enz;
return defined $self->{'_cut_positions'}->{$enz} ?
@{$self->{'_cut_positions'}->{$enz}} :
();
}
=head2 fragments
Title : fragments
Function : Retrieve the fragments that we cut
Returns : An array of the fragments retrieved.
Arguments: An enzyme name to retrieve the fragments for
For example this code will retrieve the fragments for all enzymes that
cut your sequence
my $all_cutters = $analysis->cutters;
foreach my $enz ($$all_cutters->each_enzyme}) {
@fragments=$analysis->fragments($enz);
}
=cut
sub fragments {
my ($self, $enz) = @_;
$self->cut unless $self->{'_cut'};
$self->throw('no enzyme selected to get fragments for')
unless $enz;
my @fragments;
for ($self->fragment_maps($enz)) {push @fragments, $_->{seq}}
return @fragments;
}
=head2 fragment_maps
Title : fragment_maps
Function : Retrieves fragment sequences with start and end
points. Useful for feature construction.
Returns : An array containing a hash reference for each fragment,
containing the start point, end point and DNA
sequence. The hash keys are 'start', 'end' and
'seq'. Returns an empty array if not defined.
Arguments : An enzyme name, enzyme object,
or enzyme collection to retrieve the fragments for.
If passes an enzyme collection it will return the result of a multiple
digest. This : will also cause the special enzyme 'multiple_digest' to
be created so you can get : other information about this multiple
digest. (TMTOWTDI).
There is a minor problem with this and $self-E<gt>fragments that I
haven't got a good answer for (at the moment). If the sequence is not
cut, do we return undef, or the whole sequence?
For linear fragments it would be good to return the whole
sequence. For circular fragments I am not sure.
At the moment it returns the whole sequence with start of 1 and end of
length of the sequence. For example:
use Bio::Restriction::Analysis;
use Bio::Restriction::EnzymeCollection;
use Bio::PrimarySeq;
my $seq = Bio::PrimarySeq->new
(-seq =>'AGCTTAATTCATTAGCTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATCCAAAAAAGAGTGAGCTTCTGAT',
-primary_id => 'synopsis',
-molecule => 'dna');
my $ra = Bio::Restriction::Analysis->new(-seq=>$seq);
my @gel;
my @bam_maps = $ra->fragment_maps('BamHI');
foreach my $i (@bam_maps) {
my $start = $i->{start};
my $end = $i->{end};
my $sequence = $i->{seq};
push @gel, "$start--$sequence--$end";
@gel = sort {length $b <=> length $a} @gel;
}
print join("\n", @gel) . "\n";
=cut
sub fragment_maps {
my ($self, $enz) = @_;
$self->cut unless $self->{'_cut'};
$self->throw('no enzyme selected to get fragment maps for')
unless $enz;
# we are going to generate this on an as-needed basis rather than
# for every enzyme this should cut down on the amount of
# duplicated data we are trying to save in memory and make this
# faster and easier for large sequences, e.g. genome analysis
my @cut_positions;
if (ref $enz eq '' && exists $self->{'_cut_positions'}->{$enz}) {
@cut_positions=@{$self->{'_cut_positions'}->{$enz}};
} elsif ($enz->isa("Bio::Restriction::EnzymeI")) {
@cut_positions=@{$self->{'_cut_positions'}->{$enz->name}};
} elsif ($enz->isa("Bio::Restriction::EnzymeCollection")) {
$self->cut('multiple', $enz);
@cut_positions=@{$self->{'_cut_positions'}->{'multiple_digest'}};
}
unless (defined($cut_positions[0])) {
# it doesn't cut
# return the whole sequence
# this should probably have the is_circular command
my %map=(
'start' => 1,
'end' => $self->{'_seq'}->length,
'seq' => $self->{'_seq'}->seq
);
push (@{$self->{'_frag_map_list'}->{$enz}}, \%map);
return defined $self->{'_frag_map_list'}->{$enz} ?
@{$self->{'_frag_map_list'}->{$enz}} : ();
}
@cut_positions=sort {$a <=> $b} @cut_positions;
push my @cuts, $cut_positions[0];
foreach my $i (@cut_positions) {
push @cuts, $i if $i != $cuts[$#cuts];
}
my $start=1; my $stop; my %seq; my %stop;
foreach $stop (@cuts) {
next if !$stop; # cuts at beginning of sequence
$seq{$start}=$self->{'_seq'}->subseq($start, $stop);
$stop{$start}=$stop;
$start=$stop+1;
}
$stop=$self->{'_seq'}->length;
if ($start > $stop) {
# borderline case. The enzyme cleaved at the end of the sequence
# what do I do now?
}
else {
$seq{$start}=$self->{'_seq'}->subseq($start, $stop);
$stop{$start}=$stop;
}
if ($self->{'_seq'}->is_circular) {
# join the first and last fragments
$seq{$start}.=$seq{'1'};
delete $seq{'1'};
$stop{$start}=$stop{'1'};
delete $stop{'1'};
}
foreach my $start (sort {$a <=> $b} keys %seq) {
my %map=(
'start' => $start,
'end' => $stop{$start},
'seq' => $seq{$start}
);
push (@{$self->{'_frag_map_list'}->{$enz}}, \%map);
}
return defined $self->{'_frag_map_list'}->{$enz} ?
@{$self->{'_frag_map_list'}->{$enz}} : ();
}
=head2 sizes
Title : sizes
Function : Retrieves an array with the sizes of the fragments
Returns : Array that has the sizes of the fragments ordered from
largest to smallest like they would appear in a gel.
Arguments: An enzyme name to retrieve the sizes for is required and
kilobases to the nearest 0.1 kb, else it will be in
bp. If the optional third entry is set the results will
be sorted.
This is designed to make it easy to see what fragments you should get
on a gel!
You should be able to do these:
# to see all the fragment sizes,
print join "\n", $re->sizes($enz), "\n";
# to see all the fragment sizes sorted
print join "\n", $re->sizes($enz, 0, 1), "\n";
# to see all the fragment sizes in kb sorted
print join "\n", $re->sizes($enz, 1, 1), "\n";
=cut
sub sizes {
my ($self, $enz, $kb, $sort) = @_;
$self->throw('no enzyme selected to get fragments for')
unless $enz;
if (blessed($enz)) {
$self->throw("Enzyme must be enzyme name or a Bio::Restriction::EnzymeI, not ".ref($enz))
if !$enz->isa('Bio::Restriction::EnzymeI');
$enz = $enz->name;
}
$self->cut unless $self->{'_cut'};
my @frag; my $lastsite=0;
foreach my $site (@{$self->{'_cut_positions'}->{$enz}}) {
$kb ? push (@frag, (int($site-($lastsite))/100)/10)
: push (@frag, $site-($lastsite));
$lastsite=$site;
}
$kb ? push (@frag, (int($self->{'_seq'}->length-($lastsite))/100)/10)
: push (@frag, $self->{'_seq'}->length-($lastsite));
if ($self->{'_seq'}->is_circular) {
my $first=shift @frag;
my $last=pop @frag;
push @frag, ($first+$last);
}
$sort ? @frag = sort {$b <=> $a} @frag : 1;
return @frag;
}
=head1 How many times does enzymes X cut?
=cut
=head2 cuts_by_enzyme
Title : cuts_by_enzyme
Function : Return the number of cuts for an enzyme
Returns : An integer with the number of times each enzyme cuts.
Returns 0 if doesn't cut or undef if not defined
Arguments : An enzyme name string
=cut
sub cuts_by_enzyme {
my ($self, $enz)=@_;
$self->throw("Need an enzyme name")
unless defined $enz;
$self->cut unless $self->{'_cut'};
return $self->{'_number_of_cuts_by_enzyme'}->{$enz};
}
=head1 Which enzymes cut the sequence N times?
=cut
=head2 cutters
Title : cutters
Function : Find enzymes that cut a given number of times
Returns : a Bio::Restriction::EnzymeCollection
Arguments : 1. exact time or lower limit,
non-negative integer, optional
2. upper limit, non-negative integer,
larger or equalthan first, optional
If no arguments are given, the method returns all enzymes that do cut
the sequence. The argument zero, '0', is same as method
zero_cutters(). The argument one, '1', corresponds to unique_cutters.
If either of the limits is larger than number of cuts any enzyme cuts the
sequence, the that limit is automagically lowered. The method max_cuts()
gives the largest number of cuts.
See Also : L<unique_cutters|unique_cutters>,
L<zero_cutters|zero_cutters>, L<max_cuts|max_cuts>
=cut
sub cutters {
my ($self, $a, $z) = @_;
$self->cut unless $self->{'_cut'};
my ($start, $end);
if (defined $a) {
Bio/Restriction/Analysis.pm view on Meta::CPAN
sub _cuts {
my $self = shift;
my $target_seq=uc $self->{'_seq'}->seq; # I have been burned on this before :)
# first, find out all the enzymes that we have
foreach my $enz ($self->{'_enzymes'}->each_enzyme) {
my @all_cuts;
my @others = $enz->others if $enz->can("others");
foreach my $enzyme ($enz, @others) {
# cut the sequence
# _make_cuts handles all cases (amibiguous, non-ambiguous) X
# (palindromic X non-palindromic)
#
my $cut_positions = $self->_make_cuts($target_seq, $enzyme);
push @all_cuts, @$cut_positions;
#### need to refactor circular handling....
####
# deal with is_circular sequences
if ($self->{'_seq'}->is_circular) {
$cut_positions=$self->_circular($target_seq, $enzyme);
push @all_cuts, @$cut_positions;
}
# non-symmetric cutters (most external cutters, e.g.) need
# special handling
unless ($enzyme->is_symmetric) {
# do all of above with explicit use of the
# enzyme's 'complementary_cut'...
$cut_positions = $self->_make_cuts($target_seq, $enzyme, 'COMP');
push @all_cuts, @$cut_positions;
# deal with is_circular sequences
if ($self->{'_seq'}->is_circular) {
$cut_positions=$self->_circular($target_seq, $enzyme, 'COMP');
push @all_cuts, @$cut_positions;
}
}
}
if (defined $all_cuts[0]) {
# now just remove any duplicate cut sites
@all_cuts = sort {$a <=> $b} @all_cuts;
push @{$self->{'_cut_positions'}->{$enz->name}}, $all_cuts[0];
foreach my $i (@all_cuts) {
push @{$self->{'_cut_positions'}->{$enz->name}}, $i
if $i != ${$self->{'_cut_positions'}->{$enz->name}}[$#{$self->{'_cut_positions'}->{$enz->name}}];
}
} else {
# this just fixes an eror when @all_cuts is not defined!
@{$self->{'_cut_positions'}->{$enz->name}}=();
}
# note I have removed saving any other information except the
# cut_positions this should significantly decrease the amount
# of memory that is required for large sequences. It should
# also speed things up dramatically, because fragments and
# fragment maps are only calculated for those enzymes they are
# needed for.
# finally, save minimal information about each enzyme
my $number_of_cuts=scalar @{$self->{'_cut_positions'}->{$enz->name}};
# now just store the number of cuts
$self->{_number_of_cuts_by_enzyme}->{$enz->name}=$number_of_cuts;
push (@{$self->{_number_of_cuts_by_cuts}->{$number_of_cuts}}, $enz);
if ($number_of_cuts > $self->{maximum_cuts}) {
$self->{maximum_cuts}=$number_of_cuts;
}
}
}
=head2 _enzyme_sites
Title : _enzyme_sites
Function : An internal method to figure out the two sides of an enzyme
Returns : The sequence before the cut and the sequence after the cut
Arguments : A Bio::Restriction::Enzyme object,
$comp : boolean, calculate based on $enz->complementary_cut()
if true, $enz->cut() if false
Status : NOW DEPRECATED - maj
=cut
sub _enzyme_sites {
my ($self, $enz, $comp )=@_;
# get the cut site
# I have reworked this so that it uses $enz->cut to get the site
my $site= ( $comp ? $enz->complementary_cut : $enz->cut );
# split it into the two fragments for the sequence before and after.
$site=0 unless defined $site;
# the default values just stop an error from an undefined
# string. But they don't affect the split.
my ($beforeseq, $afterseq)= ('.', '.');
# extra-site cutting
# the before seq is going to be the entire site
# the after seq is empty
# BUT, need to communicate how to cut within the sample sequence
# relative to the end of the site (do through $enz->cut), and
# ALSO, need to check length of sample seq so that if cut falls
# outside the input sequence, we have a warning/throw. /maj
# pre-site cutting
# need to handle negative site numbers
if ($site <= 0) { # <= to handle pre-site cutting
$afterseq=$enz->string;
}
elsif ($site >= $enz->seq->length) { # >= to handle extrasite cutters/maj
$beforeseq=$enz->string;
}
else { # $site < $enz->seq->length
$beforeseq=$enz->seq->subseq(1, $site);
$afterseq=$enz->seq->subseq($site+1, $enz->seq->length);
}
# if the enzyme is ambiguous we need to convert this into a perl string
if ($enz->is_ambiguous) {
$beforeseq=$self->_expanded_string($beforeseq);
$afterseq =$self->_expanded_string($afterseq);
}
return ($beforeseq, $afterseq);
}
=head2 _non_pal_enz
Title : _non_pal_enz
Function : Analyses non_palindromic enzymes for cuts in both ways
(in fact, delivers only minus strand cut positions in the
plus strand coordinates/maj)
Returns : A reference to an array of cut positions
Arguments: The sequence to check and the enzyme object
NOW DEPRECATED/maj
=cut
sub _non_pal_enz {
my ($self, $target_seq, $enz) =@_;
# add support for non-palindromic sequences
# the enzyme is not the same forwards and backwards
my $site=$enz->complementary_cut;
# complementary_cut is in plus strand coordinates
# we are going to rc the sequence, so complementary_cut becomes length-complementary_cut
# I think this is wrong; cut sites are a matter of position with respect
Bio/Restriction/Analysis.pm view on Meta::CPAN
else {
# this can't be right./maj
$beforeseq=$enz->seq->revcom->subseq(1, ($enz->seq->length-$site));
$afterseq=$enz->seq->revcom->subseq(($enz->seq->length-$site), $enz->seq->length);
}
# do this correctly, in the context of the current code design,
# by providing a "complement" argument to _ambig_cuts and _nonambig_cuts,
# use these explicitly rather than this wrapper./maj
my $results=[];
if ($enz->is_ambiguous) {
$results= $self->_ambig_cuts($beforeseq, $afterseq, $target_seq, $enz);
} else {
$results= $self->_nonambig_cuts($beforeseq, $afterseq, $target_seq, $enz);
}
# deal with is_circular
my $more_results=[];
$more_results=$self->_circular($beforeseq, $afterseq, $enz)
if ($self->{'_seq'}->is_circular);
return [@$more_results, @$results];
}
=head2 _ambig_cuts
Title : _ambig_cuts
Function : An internal method to localize the cuts in the sequence
Returns : A reference to an array of cut positions
Arguments : The separated enzyme site, the target sequence, and the enzyme object
Comments : This is a slow implementation but works for ambiguous sequences.
Whenever possible, _nonambig_cuts should be used as it is a lot faster.
=cut
# we have problems here when the cut is extrasite: $beforeseq/$afterseq do
# not define the cut site then! I am renaming this to _ambig_cuts_depr,
# providing a more compact method that correctly handles extrasite cuts
# below /maj
sub _ambig_cuts_depr {
my ($self, $beforeseq, $afterseq, $target_seq, $enz) = @_;
# cut the sequence. This is done with split so we can use
# regexp.
$target_seq = uc $target_seq;
my @cuts = split /($beforeseq)($afterseq)/i, $target_seq;
# now the array has extra elements --- the before and after!
# we have:
# element 0 sequence
# element 1 3' end
# element 2 5' end of next sequence
# element 3 sequence
# ....
# we need to loop through the array and add the ends to the
# appropriate parts of the sequence
my $i=0;
my @re_frags;
if ($#cuts) { # there is >1 element
while ($i<$#cuts) {
my $joinedseq;
# the first sequence is a special case
if ($i == 0) {
$joinedseq=$cuts[$i].$cuts[$i+1];
} else {
$joinedseq=$cuts[$i-1].$cuts[$i].$cuts[$i+1];
}
# now deal with overlapping sequences
# we can do this through a regular regexp as we only
# have a short fragment to look through
while ($joinedseq =~ /$beforeseq$afterseq/) {
$joinedseq =~ s/^(.*?$beforeseq)($afterseq)/$2/;
push @re_frags, $1;
}
push @re_frags, $joinedseq;
$i+=3;
}
# I don't think we want the last fragment in. It is messing up the _circular
# part of things. So I deleted this part of the code :)
} else {
# if we don't cut, leave the array empty
return [];
} # the sequence was not cut.
# now @re_frags has the fragments of all the sequences
# but some people want to have this return the lengths
# of the fragments.
# in theory the actual cut sites should be the length
# of the fragments in @re_frags
# note, that now this is the only data that we are saving. We
# will have to go back add regenerate re_frags. The reason is
# that we can use this in _circular easier
my @cut_positions = map {length($_)} @re_frags;
# the cut positions are right now the lengths of the sequence, but
# we need to add them all onto each other
for (my $i=1; $i<=$#cut_positions; $i++) {
$cut_positions[$i]+=$cut_positions[$i-1];
}
# in one of those oddities in life, 2 fragments mean an enzyme cut once
# so $#re_frags is the number of cuts
return \@cut_positions;
}
# new version/maj
sub _ambig_cuts {
my ($self, $before, $after, $target, $enz, $comp) = @_;
my $cut_site = ($comp ? $enz->complementary_cut : $enz->cut);
local $_ = uc $target;
my @cuts;
my $recog = $enz->recog;
my $site_re = qr/($recog)/;
push @cuts, pos while (/$site_re/g);
$_ = $_ - length($enz->recog) + $cut_site for @cuts;
return [@cuts];
}
=head2 _nonambig_cuts
Title : _nonambig_cuts
Function : Figures out which enzymes we know about and cuts the sequence.
Returns : Nothing.
Arguments : The separated enzyme site, the target sequence, and the enzyme object
An internal method. This will figure out where the sequence should be
cut, and provide the appropriate results. This is a much faster
implementation because it doesn't use a regexp, but it can not deal
with ambiguous sequences
=cut
# now, DO want the enzyme object.../maj
sub _nonambig_cuts {
my ($self, $beforeseq, $afterseq, $target_seq, $enz, $comp) = @_;
my $cut_site = ($comp ? $enz->complementary_cut : $enz->cut);
if ($beforeseq eq ".") {$beforeseq = ''}
if ($afterseq eq ".") {$afterseq = ''}
$target_seq = uc $target_seq;
# my $index_posn=index($target_seq, $beforeseq.$afterseq);
my $index_posn=index($target_seq, $enz->recog);
return [] if ($index_posn == -1); # there is no match to the sequence
# there is at least one cut site
my @cuts;
while ($index_posn > -1) {
# extrasite cutting issue here...
# think we want $index_posn+$enz->cut
# push (@cuts, $index_posn+length($beforeseq));
push (@cuts, $index_posn+$cut_site);
# $index_posn=index($target_seq, $beforeseq.$afterseq, $index_posn+1);
$index_posn=index($target_seq, $enz->recog, $index_posn+1);
}
return \@cuts;
}
=head2 _make_cuts
Title : _make_cuts
Bio/Restriction/Analysis.pm view on Meta::CPAN
my @cuts;
my @enzs = map { $_ || () } ($enz, $enz->can('others') ? $enz->others : ());
ENZ:
foreach $enz (@enzs) {
my $recog = $enz->recog;
my $cut_site = ($comp ? $enz->complementary_cut : $enz->cut);
my @these_cuts;
if ( $recog =~ /[^\w]/ ) { # "ambig"
my $site_re = qr/($recog)/;
push @these_cuts, pos while (/$site_re/g);
$_ = $_ - length($enz->string) + $cut_site for @these_cuts;
if (!$enz->is_palindromic) {
pos = 0;
my @these_rev_cuts;
$recog = $enz->revcom_recog;
$cut_site = length($enz->string) - ($comp ? $enz->cut : $enz->complementary_cut);
$site_re = qr/($recog)/;
push @these_rev_cuts, pos while (/$site_re/g);
$_ = $_ - length($enz->string) + $cut_site for @these_rev_cuts;
push @these_cuts, @these_rev_cuts;
}
}
else { # "nonambig"
my $index_posn=index($_, $recog);
while ($index_posn > -1) {
push (@these_cuts, $index_posn+$cut_site);
$index_posn=index($_, $recog, $index_posn+1);
}
if (!$enz->is_palindromic) {
$recog = $enz->revcom_recog;
$cut_site = length($enz->string) - ($comp ? $enz->cut : $enz->complementary_cut);
$index_posn=index($_, $recog);
while ($index_posn > -1) {
push @these_cuts, $index_posn+$cut_site;
$index_posn=index($_, $recog, $index_posn+1);
}
}
}
push @cuts, @these_cuts;
}
return [@cuts];
}
=head2 _multiple_cuts
Title : _multiple_cuts
Function : Figures out multiple digests
Returns : An array of the cut sites for multiply digested DNA
Arguments : A Bio::Restriction::EnzymeCollection object
Comments : Double digests is one subset of this, but you can use
as many enzymes as you want.
=cut
sub _multiple_cuts {
my ($self, $ec)=@_;
$self->cut unless $self->{'_cut'};
# now that we are using positions rather than fragments
# this is really easy
my @cuts;
foreach my $enz ($ec->each_enzyme) {
push @cuts, @{$self->{'_cut_positions'}->{$enz->name}}
if defined $self->{'_cut_positions'}->{$enz->name};
}
@{$self->{'_cut_positions'}->{'multiple_digest'}}=sort {$a <=> $b} @cuts;
my $number_of_cuts;
$number_of_cuts=scalar @{$self->{'_cut_positions'}->{'multiple_digest'}};
$self->{_number_of_cuts_by_enzyme}->{'multiple_digest'}=$number_of_cuts;
push (@{$self->{_number_of_cuts_by_cuts}->{$number_of_cuts}}, 'multiple_digest');
if ($number_of_cuts > $self->{maximum_cuts}) {
$self->{maximum_cuts}=$number_of_cuts;
}
}
=head2 _circular
Title : _circular
Function : Identifies cuts at the join of the end of the target with
the beginning of the target
Returns : array of scalar integers ( cut sites near join, if any )
Arguments : scalar string (target sequence), Bio::Restriction::Enzyme obj
=cut
sub _circular {
my ($self, $target, $enz, $comp) = @_;
$target=uc $target;
my $patch_len = ( length $target > 20 ? 10 : int( length($target)/2 ) );
my ($first, $last) =
(substr($target, 0, $patch_len),substr($target, -$patch_len));
my $patch=$last.$first;
# now find the cut sites
my $cut_positions = $self->_make_cuts($patch, $enz, $comp);
# the enzyme doesn't cut in the new fragment
return [] if (!$cut_positions);
# now we are going to add things to _cut_positions
# in this shema it doesn't matter if the site is there twice -
# we will take care of that later. Because we are using position
# rather than frag or anything else, we can just
# remove duplicates.
my @circ_cuts;
foreach my $cut (@$cut_positions) {
if ($cut == length($last)) {
# the cut is actually at position 0, but we're going to call this the
# length of the sequence so we don't confuse no cuts with a 0 cut
# push (@circ_cuts, $self->{'_seq'}->length);
push (@circ_cuts, 0);
}
elsif ($cut < length($last)) {
# the cut is before the end of the sequence
#check
push (@circ_cuts, $self->{'_seq'}->length - (length($last) - $cut));
}
else {
# the cut is at the start of the sequence (position >=1)
# note, we put this at the beginning of the array rather than the end!
unshift (@circ_cuts, $cut-length($last));
}
}
return \@circ_cuts;
}
=head2 _expanded_string
Title : _expanded_string
Function : Expand nucleotide ambiguity codes to their representative letters
Returns : The full length string
Arguments : The string to be expanded.
Stolen from the original RestrictionEnzyme.pm
=cut
sub _expanded_string {
my ($self, $str) = @_;
$str =~ s/N|X/\./g;
$str =~ s/R/\[AG\]/g;
$str =~ s/Y/\[CT\]/g;
$str =~ s/S/\[GC\]/g;
$str =~ s/W/\[AT\]/g;
$str =~ s/M/\[AC\]/g;
$str =~ s/K/\[TG\]/g;
$str =~ s/B/\[CGT\]/g;
$str =~ s/D/\[AGT\]/g;
$str =~ s/H/\[ACT\]/g;
$str =~ s/V/\[ACG\]/g;
return $str;
}
( run in 0.744 second using v1.01-cache-2.11-cpan-364913b4093 )