Bio-WebService-LANL-SequenceLocator

 view release on metacpan or  search on metacpan

examples/rest.pl  view on Meta::CPAN

use LWP::UserAgent;

my $agent    = LWP::UserAgent->new( agent => 'you@example.com' );
my $response = $agent->post(
    "https://indra.mullins.microbiol.washington.edu/locate-sequence/within/hiv" => [
        sequence => "TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG",
    ],
);
unless ($response->is_success) {
    die "Request failed: ", $response->status_line, "\n",
        $response->decoded_content;
}
my $results = decode_json( $response->decoded_content );

# $results is now an array ref, like the JSON above
print $results->[0]{polyprotein}, "\n";

lib/Bio/WebService/LANL/SequenceLocator.pm  view on Meta::CPAN

    my $self = shift;
    my $req  = shift;
    my $response = $self->agent->request($req);

    if (not $response->is_success) {
        warn sprintf "Request failed: %s %s -> %s\n",
            $req->method, $req->uri, $response->status_line;
        return;
    }

    return $response->decoded_content;
}

=head2 find

Takes an array ref of sequence strings.  Sequences may be in amino acids or
nucleotides and mixed freely.  Sequences should not be in FASTA format.

If sequence bases are not clearly nucleotides or clearly amino acids, LANL
seems to default to nucleotides.  This can be an issue for some sequences since
the full alphabet for nucleotides overlaps with the alphabet for amino acids.

share/about.html  view on Meta::CPAN

use LWP::UserAgent;

my $agent    = LWP::UserAgent->new( agent => 'you@example.com' );
my $response = $agent->post(
    "https://indra.mullins.microbiol.washington.edu/locate-sequence/within/hiv" => [
        sequence => "TCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGG",
    ],
);
unless ($response->is_success) {
    die "Request failed: ", $response->status_line, "\n",
        $response->decoded_content;
}
my $results = decode_json( $response->decoded_content );

# $results is now an array ref, like the JSON above
print $results->[0]{polyprotein}, "\n";
</pre>

<a name="python"></a>
<h3>Python</h3>
<pre>
#!/usr/bin/env python2
from urllib2 import Request, urlopen, URLError

xt/live.t  view on Meta::CPAN

                %{$test->{args} || {}},
            ],
        );
    } else {
        @data = [
            sequence => $test->{sequences},
            %{$test->{args} || {}},
        ];
    }
    my $response = request( POST '/within/hiv' => @data );
    my $results  = $response->decoded_content;
    if ($response->content_type =~ /^application\/json/) {
        $results = decode_json($results);
    }
    return $results;
}

sub request {
    state $app = Bio::WebService::LANL::SequenceLocator::Server->new(
        contact => 'automated testing'
    );



( run in 0.522 second using v1.01-cache-2.11-cpan-39bf76dae61 )